%PDF-1.4 % 1 0 obj << /ModDate (D:20110729181516+08'00') /CreationDate (D:20110729181516+08'00') /Title /Subject /Author /Keywords /Creator /Producer >> endobj 5 0 obj << /Length 6 0 R /Filter /FlateDecode >> stream xK$&g=@qH@ `.0 A5j ^F:IQUIF^ݷQg}gփMpi4ڐ?F\__m˵fqޅϵFw;!#TFۿ#}ihRL||Í1I>ƅJj-?+慈q%ss`\ 4R_e+g =/ߥJҏ_#DŽ6# "?߿ƹI" Ǹ%{K%OZg]S,60JXTCĒy+!xO_5c ?n"5x$bʰ2O8xk~q8AQqrys~qa[ U&RT:,#eoa-]>O8] -W,3qck|3ʯnF\ߡ á'ӟh Q QZWokO~=Cb:tL:S>,4RKvC+`JE:N_ _7|k2H?_8wJ˯_c^+1L84bFX~>=/.ad  F?~| y0#Zpۿ[ 郶/R/*.0Gr`?Y|!0̺pdžMnps ’F 1cqONyft >*5.Iwq@6ws&&S_?y2U8oO 7|,o_{8 ύ|};h *esy5O\AN\+\l [&.3߷SG>fq{ZcV=&|7iQ ѐ=UDKx_g{+)A 2(o| ; ݷnƘG_E^+ ⺝@%V`. @7qꋕAɮPbE?N|J#n#fL5MYgL*|)SjLPlȧt\ے*62+tlx)Ҷ;S ?Ig3 1 ל[@׉ii&pn-AegSZ'4a1!D ̡gV5ohU }qWM[n'fAi1KԪypRTthqHLoHBWā'ңo|{)n@V0NIC|ˆ%}cyuϓOaP^"XLÓ /<z|\\0R9>h2avP 75n#=CYBΊG_k?h숨a"f<="méoNAߠs|#}? A˃UCEatFhDYȢR42kO>4FwëN@qg$s? w6?7^Fid9Q8M0k.ѬQOk~\NHyM\;wN)#o  ,\*hɭ}Yv#f㪿*6[_?V`fqg+ 36$*2Qv.rWvN/'2y6VLc @D*kB.=J2HxۇyUB3in:p/ YW_|ւ'tĘq\[}1OZoZA>@4sV1J|Sc\q,ywv@AQN3XݗAPal A_2dzX!A(NזO @4mIX̓af&2]>|R 5Q>p y)f5OŞ9taMn^̓]ּ;c|iތa&!}ZKY"*RzV%whՒXHX` !3 A#grG_*w{۽%dOTb^{$kp:t}KUs)x+\=x} w LkڞKj*̔#({ @$XHW5Ңyfj$#kqF?=H>"ϔfhnc$Ɉvۡ0U\BҮ 'ɹWwoj'ɱBfFMwUQ$=yi+̘hct̉E&vq񬞊v9[wrbE>\qAlկ*7Ir(]z$dJ7#Fpc%N$y3;Gc*ZRXl5Yc9Fe+j#MK=ӏ'.HSNg21~f\ukl{|Kg[PIof ښRw jy'OeQqlܷG]%î \Td圣b@˯LYz}Q㬯fƵRfb'(` J_qy/ZA}'60kݓfS7NPd+Y ~R2#4^Vbu ̘WwjK[BZäl1g\k]rjbU S>ᩉ%l8eW6 #ݴhikSb6Z]E<EImЩ(SzlTK'9T5EQ#uDթX}$N}SI"R?:*Vku/!0-l3[҂:t-[(}U0E#*uĝC*/aF1yZ05.F8c~$=;jiV *`J}]*LH3d|̽#~of#w'O;~1룞 OO!Y&' "CP9{GȾ,? ń8rb@3zT0.hAqTa|c7M ?gqP#C '?sG֒/Ӻp&6u\|Ȼ+)<\Rig@](2܌"SA&)#'4ƘF[u:wQ+k"]WFzn1[]uD"L8<+A3G+azκGAiFP`iL Tk괲{M1Gfٍ dH=MtǴn8ܦ b|A1c~k G.ʇrȍO5*)Ӭ^=+1%{ɤ:NSP jE1N]3zQg2UY۸5uW{p3E:`3??1{m`Nуx=^%{͂Fh/SZ)ͩ_0t[,9l Av܍&Q:+I#(OhDu{<#|7E_oA0b(0MݻA 9[We8Η!vV>K׎aMxghvqy;A]сFeds W+KeUf7{N!>7~zK;|+ϱ&%N|*Oyd`='ģY=4P S3JVkF.YO6E驴pzk%scΦ珌#X֋i_BC-ZfcDuk>F_,F-_θ}O&iP&YwvN}A1jRPϗOQz7%扗s0x]L+O:LGKK}Q6\q}Ƶ۰_j[m;62^z,aw6!ߢ\T 0]*VCa2!)\oݛKO:cHMgՉpiL C0jnHLsY.#մ|k(o< ÛkS*9sBoJpj!3=2KGkA2ZfEē@ e6ٌ8Ƚ"ɽ$YQF1beIf&_W+l'X;WN6FO)8O>g $V'} ^V۰PmxZ!d_$з嶌k>s=U+;%C;l7bCF[CyT"Ce6産0:LRχˆC<m]}V6?.< y`)4cJe ye@M_.Ul㛙7Jha&c50SƊ&y xH>d,Ncn+1K5vt,7Z/aZTLb[f+KNk\Ƶ}M8`c~|nZ&xW#&_v *Ϭͼp |g 0@A<*"KA%׋RZ7KPެeSE͓giz#䲣FȪSآ0f2XP_ sSf $ăfӤnAtۯW2kB&ءs~%p+.cF~aںbG d3*r]-{ֻ WrEh#[&;NKDo@ +E٬;0bVF5/_[NϴhV(]9Dzr?mqy'drK̳ʌP9b|FB>h+OIL/MmĢ5·Sjs9aZw.=.U =Ѵ%sLc1߈;dmCaM9m$@0nM亙-Kmf7 fYO%+ BFigTMPQzh򉉯:gswL3Vhv>1W/Y+?+ۘhŬ)x]S~=j~:I/Ml) }S;n]58TXiEz'RIr\zF٢d?Dfr@wv]"L`2.FIx&՛VM:ǚ&iW'7H=^:->Jwx"^h̓|'Y{i%ym fjTve90󩮗M #tY+Q%3x5;;w.Z[Y?~ Z0RkK涽vnsC3>_L)IΐIg8/(|g+z_|wa{p/\7YtDb.k_EݭY9=le&WihJO$GݨD~ϸzG[Z31qYc _P&*+ RG'.(ffbżK,pᢇz <̪N<kdXP6%Â6W.^nvvh[&Yq~`-'2C`o!+ȧY)hq̦lESnF#!.Ok1EW[޷:7OMV14ك-k}S)Kirf$<+i,{2G^3G܌la-((Ud*X:\z$gB8yIhF%#?+sL0+E3k o5dP[5Fv9\V +MqIaNPkuYB1??Q> 4akk>~}o׼tyX/,Kz ܵA#^ymc<1ڪdM`WVB<d(m_V2֋r (_0o+ [ ;~\#ޝnGd69.= - o͓Oͺ=2ϴĎcb8Ssm|yʎ'fAmi?aF ٍY 7jS5?u,w%ΜdmLϟS3O8]ЊG; >{GGeI=*9`s q c=O1ny; ZvpVU OOOk6GH˦$(ߜpW,!utD8="0s\B>`^Gֹ=<72ؽ#hLK˜RMKiɼQIcȽj$]9Qe XPXpi!2gD2]~e+CrEOauS-!_А|mL Ju=WOjsx Yߓ |yMGi79$ܾ&]̀YBZÜWh fB8I;9NVVhf{O'%LfwLiJFcQe^f$fj0ԋŽp >ַ5q5!}zuVI\BZfJ>=yncNKE`ՋJ!kW+%}-8F񖌸5 Qz<`FF '9vm(unsA\Fwa8_w{9˖M>-^ә X}J'0Q+y|vD'(?A+>2h,/$LfV͙=ϼ؛GS_&psO}]/Z8b<en?zfS;[B7c8#-ʵDmr!71eY ;ƕL]YҽÿX#{gM,2U>$H-+#>& kU}^~8c'<=ĐL +(})H^|XW)͠O8iG\xw`o>%|cN"~~ 8d9R݁̑gXj Q~bȌR)&L((1{GezGށbY^sYMtZDKd҃`(N?vk͝trAu/s׮OpyPX_xW/ΰ/l[=]WAvQ&t}NIwtKg{;;# p.F3*oǵB@%̿2(+/zV%e&2puK~#4¡W@=Q X>AKȧ5ʭA̤ ΞL'?s 0FXO5a5a5eXh|"̔jvyun*XbjUlMn$lfEc<郹7V4F^ FcΜwNNQ8_=0hhx%ފ\%/@R&3FZ51 0mVb+xo~|YEkrIb_#d$/W0fB2QaZ<]hܮ zoWUz7Op״xאm o=wmYF&͛Z6zY6: ) Uc:J@ uB7JԔ *F EPE傺9j]YKHk֧-! _ڈ؏G#[)3=(h~}ۖEd;,F<58lAY؃z-e,!_w/xXc{q`?zlĜbNX^a$qc ^vHZeU#jE2*7H \&}4bLAI:֫ϥE=*#t/{Axdx'^9#(53F' |I"IfZw~swWEFbdWeBͪ#N*k%k>j5ZuTo"`F,nXfd=]..ZI?_0Q>`{>f͓ϰ_ކז1횅AʉfzSS'yc,iX/!_ m'yx#BRg1;5JI)yC!I;L^F).{xW/h@sUGz6xx;Uub QFkm8w.%R㕱,t$$-ʿA=16įX= y#!0,!bJ7{kR/J1ʕ$,f^{z",HzJE7?~E%vKhF<3993@[AJl'zlqSA}T0R0ޮK'v0M3+3q4A'Hu0JJ6=f YLjS}yo;9yi<ҡyKz9 .?dɧ vfL ѐV0RŰ|ȼbM%z"?ԧZK8=UALI+0R[ln3Ӵpw~h9#FiU֩Kʚ+;'fͽ}qѯn+r|.hͦI ڗ O]us:wOFLDEh6O/`Zdyd{>|t]zS|yS ~Z/qg߯Z߾r4XAM6ʠbcbSOW=Q.=AśUvy򽬀=II!S1 l|3mFǐ,yc&?h yD3 }.IOң?v*d ^Oie;گ ;jJNԃO>"mKu5otX· gOr~g=F?7.?'nY9Z"jR:.ìiKޔ}n|_Π]cR}ct9%P k~"?_ȿiŇȀN":6x1s݄!:k eFj 67~s*#fyy䑩|gؕ #WFN'[>jKɘQՓ2V5FϺmV|AՓ9_)1mi3XeռI<517~VC֦bQEG`RCrxB0TS`0ͥu3f]AWtm :Wg 'Rr@K*Ϭ2}l\OoYb# >HʲMMk ^YMRXh]Rݷg`p>=A;qk*J]2JM噐wNoH~+|C3o>M}#b|V"h;J-ǧ`G_;q.aXHsY"TWĕy,Ye/0𢕧-ϥ&7[@p&GrZ٘QJ./,֯aux.o6=j&2j& И4 n6ǮRi. l[;E>~ETf䙒J0`5d80p^w6<,^7/LlO4D5FҤS+Z~E/RYF$O%&.4亞'Eݐ-5O E.^5ǜӄq=Lf181a#*@17܉6"`0 fѤ,xVcd,vK=UTFZUaO(1Q"$<( ujIQ([nQ[x4oxFb1<#BAW,iO€bO˻(6f r^ ɳIӇSZus%(sL٦ ǃO{:yuc#7~Qpbad#ΦVwHFi$t0 [E݁p ?8E3J:#KvM9"Hn1RIwM<~CVAjʹQox>lvǮ% aE4_n6~tόOٯieTF}mA iSy%$́f vxkKv;W̍XO fuInӏS0dݎ'毘>"2˄2hϴrzضH#/atSKk%6o K7#8h|wźJ7c;b qQ8tb9lEʳy.2WgɊ܄7~d W}Q;[V|&u*[P?>S]GYx6W'eƽ#e"zf>a\8hx2Lij{nA7?%+ ػ̲hp5NmL7/JkE #LFK8~ |l*‘,]U*!H303;ӇS^tmL/B۾8[ktztkik:_#\ -Ux ӂYѴ"ܕs'FKpc8"JDXe7U_ HUP/{A1}\ēn7@f6.KZ9)\{I>Fg{,dG_"+((ƂlCRPCYNw92˝u,,tݳ`2M<Sx.P|ĿU:h7n;a.F9p?+SSnMs7`ĢqXSO1=$cTv1ǭi85Ne3iTBh: 5(npJliڐ#wx#RR][nf N܋⹘މ{X5Xxa()Xcް`yh.9޷txֹAp5w~E&!Abjs$ޞJ3;y i_^ci>?@<;9fFcn?uQWD#px/Y1X@ >'^w:^u6>u抛y)Δ+):'MM+͈2`.i6ӬŰMLQs}:Hpxʐ M2)n<6 O$_*a;`8 1e8@T$.A"Vf7'LO3n\+ѓ:p7՞0^OΟ㚟'K|")sGnLРlFfG{%>$qTYNC;}%&_ypA2N0(0o,vOY~Ţ\[`5e˔Z# .;nboÖE54;-q..>vg&ؕ ӜQ< ^G|݉Rp"!Dl>.A9Q&wiP*of]~b>h'K$wY8СTU'{̚ 5aQxAMr.'f=.x2޵18ڌ]i!ڼة!""AԠNxo; lJ<Nuf"&ȑ};Ȓ6,U戔yNjKkICR&]KQG4`B{xXHFzrVEb]qk}ʣ<ӆBy&yUrPkBL9okAS{2o#  < GFJGLHO˜2]RkF]*kFu՛(cIsIys ʁbusG$~AӬv@XRdFEʿ|`0eb$68HSFG sιgbARD5gTG)D(!o%}q1O̞A8;)` jP;C9&ض_} ?ǟ/Jl5̉ZhoA; >V&d ǁAQlg3/:f `Ac }Z[uߤAus P֛pG5()T0Ҫ%2^8 d6Mp:&h-]27[ :TH}/z*<S窣 46L9+h \*mdf]fUQ7(bBBY(~敇ЂQ<0fN=vV*WT!9ODnB:uB0-!Qsx4oL@ -kLS~z1w\yj}XG!T~N Zwgh[: N5}C"fw9TC 9&<8n-hx:|h5bpċx5hʇgfkx)*M&jOW w. An ?Hך(&fcF.F&Mx^Z( r k-PqaZA<ˌiw|7ϸ堐"iMBmg b/sEKUS_IXp*VHP}qG \}K 9e/0t K׏ېhnLxø轾wDW2rXA<nR-OF. Lj1*JSAn*47q L#?ŔQ2u-M ][4#+PQޝG=rB Ȩr :pn.uSYR7iXhIgxVMު D><}<̽X3<`TتP"P8^6{lj/{eah E" 3Jt3>CŒKyq`F) Ϲ F1k>Zgb #2 iA)v4<~g2(+x/r*oWAW<}Oé0-?꼃LT`b*0(*'_tfWa-0Tpd8Z~A6NK#^77IkTi 7"6%,p_Ԓ_sv 0ۺ$E|r4,{5͝KX}؀Z4vs Y>ْq^` Ff\KXA<TdpДB`O6ݡ#eТѢ4pN0 '|F?;\G .8$J5t3\MErxiB苼Q$uE=y[ sw d2<!{}WyN*(; IbB0@6H3/yϠ.;=O2JN,ԓ+@WZ f*ͥ9Zevwygĕ""y|OQL焰:۫ S#( ;ARgXbN/׭<7=yF؅ubX㗰xy>MavƔۓw4+k>-9?p ZFrO4{ͤc5ዅ_{.v 4661Z&iR^~.٧6=ؗ[s;()wAZ4T-yDz;IJO;Р6'1OWډV*+vٙoP3xw ;(3eB#'{RwG{%GJYۈ2Eb] ZԶW%[ڋ!lx ޅY._Pc|3B&T~eK&[dJp3O@iwͦԹy`@lZ9+$1XG9e(dt8_4WwhUV ǜSP#崠qQJ8-b_F.n`iW}%fqp͕g L 4(L/:UWu.;xzwqXj쭢^YtuM'lS Il ֜1<*>KWdye}B>SVIA*h+aa U#K扞xP׍˒\Ap?&/t'&q'\@D<2I1_<)/`O"۵G}xDe;_<2f/GyH=O_D̽#Yv !lVig[L ߵy dP3Z枟a2;fDjϊy37؏t̀()dWd0'x)R-\eē)G}mepEFBRER#S| E5Md%x1_v~89]m3Va;sJ="u9 pbGoN24uJIA#-JtDȌʃg%Cr g4eoĶi.'Qq\q?Izm}uRN_>~ ?Rww ,o@, @UOρCv&|$="֝@$dY< r{b mQŹ%w%f?Wcː?OX}ʕ3믺b\7Y섽5~a??x=sԳ 1E ۓxVSڧÕ)rkF懬y暼r|YA_5\xLl ]ؒAXrId.脎qA3a`W6 _~=WWᙔQ4El"f&k iN{ cʷ3*sC'eF狎#n!yJɄ`E4̢2 f##3n18Ҩ&e$YLQ WuM )kim'qqBMoCty{}Q6MD}FS8y0+cꥌ+g}6F6A]uwMzr+js&]Ԝ/w\*2֤˞ZhfY1a)9+N2Xh&c,0/b_ü)fh})o-0)n򾭖" mߺzP^S\QETZ%Uw()\q(%|ǡ&YDGy h&xc8s^5N1VD{TW唁fV*c.y~_@ JݮV)r x>տa-Eg8dKٞeAׅ!< [0ƺ ŤݞO#YcLιFiw95ήKZoNN˖% TƯy1j`/mMy  7W im xjP"KT]񯰰(KMwet"gڴY^jp0;&eɬGIA#EBA*h#iUᜌ@/>IhrUUF븾8]RbtF k}1RE9(bn&yvZ@<o)1&Q>LqDȒ6CK)WgI2nq; b:J18\@ӹ@f7\?IFgvX)3e)rg,V4X<$a-Ղ5B7H۩}sa<^w;mfGiOmsnF-(.:qi:x iDklfb޵0VV 0h%MAIL~>e\){6ķ5)D6}sD^#2&'<ɤ\m W+n=;uX幋|Χ>O qTsJǗ>ӔTmF۬;aN}+)Z7-q Q*ҤMɻ#BԃnJIZ6R(|%]ypu^ws 7JG!]DCeQ^md;J_S%'vE)GS=cp̄=֞&Ho:?RcJFEBX~QnMԺK7UŦ8,0H1UxP14 kIQ, $J EsQ"82S%-Qm0DVU ;H7Wa*Y]!j{RR D@|? ܯC~/Jx`H*LhVњȁx! zŃuyʐ:,qѳ8/^65 .>{)# ߥE]w$*ŴI}q=A^jy&TLA$Do!k" ZA<˜h%<.K0$Slt c=OҌ7ֶ$"ּgV)2Sh6r'kfte3i[[WYOk'aҢ􉉙Ÿ-6E]5ԡ ÓI{DCykм.Yi఺+{.2E^N|eDꥅ5n:0Lj3o'F\;FtZԩiXd|ii 7M19Em $wC"mʍkw.';_z0/{RW5ک-Jo];Fi ӌox,?8v,/n=T '9p\F^0gTʳ*i2x.8GؚNzrQg; E(DcPO2 i"H Bt^02^0P HRРfocw_g ngjJȑ4wKf﹂++"uOU+{*-Jsz{?>0U+Ql.n=l> d3L#?qzH1<_ȿrڅe7V!okf_#Y&߁ky07eG`[\|'3֘Qs7dyԺ!EcoX*3ҘR3cE_cǁ3]D+ (V` ^1Qu (9s:WxIhf\9$V/vc.-j۔W.#-Z訾{EDA[%Q}\VM1%'#cZD jU$TPPHzёJLǐ/ 7(bJ6s 3JɆ4B: m)չ y?*z0+rh02MmWO3֪Se&(.DENqEݷi>h/ͪzֹv#󜮥D ئ (,i:{ě4=&9*kJJky]Je15_Yp9f5kYEvy#D=o^",6Jb>2EMZgw])[vqoN g857'LQ,xyeEifџsibC<4nwФC섊x-[f*3A5op{JW_;iVNJ_aL3 ~Gv@uy)ihN\8YeJv*l=ȵ1o8@sg:M<kr$4qݾ?Gi'K #{]rE2f.\TlREq͛"R9Ϡ]@pznw };i x?>\Gd"-rcXOag%6 ?#^sz '4s0=E{ ٚt˞JgǭQI:e?f 7V|5N|ibƙ@ .7nZ(ŅuhgjBnAER6!<ǵ脽߹aM,KP4 ?濄Ϗ(o#,gm^aE|cR[^#(njo6:} Ǡ҃)l9aS#Nx{fE!?Dg-=]a .R`ÿz/?_O+>,~g Kaﵠ5 LD}u-0*.BQ<5\]0O$Nԃ2JUڠ&fM׎5̺&f^x1S#Cc z:#`$apFql*LuY< r=̿ ZhZsh6~C!\zRN lEjSAlf]y/i(^~}h G?Slk^2l>͇hӦHX7Ӝ)ɛ%o<zr f̒q'< ^D'F"͊']s|Sm |+<$7k[PRSNQS< L8w3)zuaI'ZQ^yYeAyy.iyv$o|G ]!NNn`N,P(羣PT4GU9J3El9F@!3%SBxUs*MP—}zW@!%0|?>l :f ]gtg)~Wzz.h1v?sir i:b?̊REl3 oܡچ;1٫[1a,\漕bw JtOpESʼG.}z ݞJGjyX2¿)1^೜, nSְoefp6zK]R6yE)[|ԕ`^n}SNh!߆6iLQU<1 Ϊ^:Pi{ qAݰb e)<3@Y)ݵ:.뉳*^7Ļ\AɄƖn[:'H_j,6t$/} rh<ݑ|27ySI)¶L@/Nl+^UpQ~eTC\>\AQ`e@`{9PzmjO[GDj#="G]="!*Pb=EC5LL1vؼǟÉ#;#|nCB0w~̆ڀ^:ݿ:W &zlg^;p{#pAOǀ]@i Q(֏ҊInQ/mg{'<.AmI줴gqgkH_ŝYT~ʤvÝ-hp^"+8EdO0LyCqm@SN$c-)?7$R K=:ѓ(-D"3+Ig؄y@bfS'iinfy :ISPũL;78;PPKðT -H f@3oaT[g+}'.Cݰͺ2$ôQ'M3D zU67 cЉbK=\TX '"7YPލȖR^Ai3q9viAci{ejͽgMs/N@u/DI6Zr}4oШ]QOJp5 $cn!=<݃UYIfԽ`kJQ'f48C!.ݭi &܅>y X-NuC'dt/$\ZށzuK:.RP[Dno;bkA*EYEH ԁ3ZBz*1㻂@Ts؊qld:WA~gtgJ},T؜1&@/#=t6jëLh(a3BԂj64 Tq5n@>*!]:pg외E[X 8)WeG$܏]Qۜqh~ ,rz+.DzÖzcw~;&`` >ߕ;?Ak|*R[``SYJR_p)~k(kFddxv-1ơ+Cal@ӄ3_vz)"+i&ԒEQ}/q,%ɤ,~ԕv~\@˽!-!u}_t!Bڐ[BvGkppB:W>>jٯնreDM#jN}sht뫡k^i=>7>{pzIgڿ)=l}Jtcm.jgm[ H>u{4ьi*w(k|84& pg*[X0<ܘfaZ&ptvdgzGpeըp,O9WtjkM_ q%:rp`M q졐} Ō Ǽڔk8)vޫ9660/3\"g6bD$K-FF\G-RNFْ(3O*}`T0&p(C-Ɛp9ARDsz>7\jJɄ'@MƗy!Eq18an~ RI 8l0a7>9 vXM!z;?cwg'֥pp\W[qKs BlX 8q3S.䶅a8nzJ5SN[:UqsePw;uSLKۭ^的K@+ !)G6 |!#f@(j9EN9&<';rz$q88Z͓07d\8DהuU=^3v E${N\rK<1͋ KI%/J!Y-6N檶&Z*Jg{Brl` @ ;Xۣ7v@υy F{sbOlno";S ky:vgmg<EvSt@O1օ۴# 7Y,eOX6Y,D'B4hnAs:B"*jw p=bm81s#5O}VQ{NMb핐 |KɍuEsy¤l?_G{ܿozzqRHw9%)\Vs34 ~8ѝb~0}+ 9JLVr\7uzz"S}(`=Ŝ}!k2̴%a?Oǘ؛?Dӡjp'sǣXeoE<f_Ш[CJAQ!w¤lZ\C|[t+{ú\YNnu'qz I%5\"DwNlTh(fB}6n@/\N2+Q79:HSUWhMs-mɃnEyg0# HBg2϶I8)f"LM8TD pi@zk.r@ʭ ms}9Rw<9bvaOw6aف&,JsҤYM]<4H)9K6Q'{!~ح zoAM:>))e:q'E}xGG-F`Sh+Br%:~g kX_W8.F RۍNJ8HYQv,6% endstream endobj 6 0 obj 32308 endobj 4 0 obj << /Group <> /Type /Page /Parent 3 0 R /Rotate 0 /CropBox[ 0 0 1026.2656 1479.7936 ] /MediaBox[ 0 0 1026.2656 1479.7936 ] /ArtBox[ 0.8633 21.7683 1010.9755 1447.0002 ] /TrimBox[ 0 0 1026.2656 1479.7936 ] /BleedBox[ 0 0 1026.2656 1479.7936 ] /Resources 29 0 R /Contents 5 0 R >> endobj 29 0 obj << /Font << /TT1 11 0 R /TT2 14 0 R /TT3 15 0 R /TT4 19 0 R /TT5 20 0 R /TT6 21 0 R /TT7 22 0 R >> /XObject << /Im1 8 0 R /Im2 12 0 R /Im3 16 0 R /Im4 27 0 R /Fm0 23 0 R >> /ColorSpace <> /ExtGState <> /ProcSet[ /PDF /Text /ImageC ] >> endobj 10 0 obj [/DeviceCMYK] endobj 25 0 obj << /Font << /TT4 19 0 R >> /XObject << /IMA0 26 0 R>> /ColorSpace <> /ExtGState <> /ProcSet[ /PDF /Text ] >> endobj 23 0 obj << /Length 24 0 R /BBox[ 28.5688 431.3268 176.2143 462.7826] /Resources 25 0 R /Type /XObject/Subtype/Form /FormType 1 /Matrix[1.0 0.0 0.0 1.0 0.0 0.0] /EncryptType 1 /FZStream <43413331A24DB9030165484041E2DD1AB420FCAFBF68F681D6CA0C32E5C389D96FD18EFAFDD3B3F91ECA6E3A24E7BFE2C0E91DA0006BB41E4AE3C3B6DA9441C96DF9DE5F612CD881B900ABFD14B586409396FD0D1432EF37F2BF38F13DE5938228361572B0F43D90A00C72FB5497815168646D48FC0B8A179F935586CD4F37167B1817006817015FB0C6BACD44FE8D62879B96915262962AB531FEDB68258FEBB86FE1C3E2AD8B594E8F0194BA8638301248FE92962ABC40F09A5EC4105FA923F80468E4CBCFA771388D00E34D888EE502BB10F0D3BF2CFC3834DC1C7FCABD59615DC42FA13C895E2A487096FE4AD4E9BD089596E8A4B013A111A335897373D47B314BA6585EC32C58FE051D6FC6C49CE3B80AD15240ED639044990744E82979911E9320587A3DD9C3D8A9B172E25D4092E73709DBA29E167E64A37B121A95DB2DD1FA03E33BE237168407FC97EB7AEE777A8B71B8769252D155F753F84511C65047933029CD76F857D168CDC870BAEBE0C93F6EAAC30C1EA49FB8E3B7DE4B16B18F7742E7A733ECA4D000F2E4E5B79B41799784CEA18DC2CEE02286BB72D2708E114009C1960EBAD36A98728F6C0943A949C441F2DF64E3009049DB4A0B20ECAC02B9E3C7C48334EFD4FB5F7D5260A869F2253B28127B828812C8444B308471462671B581D850F4F9196CAABEBC394F851FB8D61BAE5F7DE82CCBF76F77AD9A8C7653C333BBA8E5105A3E1E068B6EB5BBC2F3F8142949F346B77AC64D59EF6EF9C2F45AFE55F36A1A1F5DEA9ECC9247AF3BBD91FF0BDEE51F8555DDD2ED25A8126188FC6BF23C4EF13033966AFD92843BBE86153FEBB96D75F362443D0AFEB180A74D226B3CB183E67B998175C1D56518FBB3B5F7015243BB1B1B110DB5EB7855A7383C2D0F833F5EDD335B6E1648BDA247164E189DD8A2A10B0F1DF0602E4569BBC7CDBA2A66136072BABBB8FF46309B12E78ACF02C45D9719E0F7FF7086E4062CA366DBEBF87D45C04D1D558DD22A200429632FEDE84D73CCFFE042DAC90A6BC234629F264FFD5101B7C6D9C950345C96FFB2D79D02BB2E30A4893BE34F3AA2901A8BA12203EE23B3A085C1C4ABE198CE42DE675DF40C3719919C7220253FB97D637F5C7C6F5E199861D61725492E3AF12A0EF0083584E7F16F9EE07DE09EEE2767F7D99EAE0965051EB610AF31EB411EA9EF150C1CC7330B10368294A43D4674AAB734932CC4ED4157387B92A6E3032B5CA93C528431F1AF46336AD827DC7F328F319EC1C041E1499436076E76D5BEB7B6CFD564D323D9C49ED22BAA2FCB83BFC4E76AA90BFC0DC3146C588A10C574AA1387EEB23F02679E5C4ADA5E4EA1AD84DB0C3F82BD7B0C4B48D4342524C063FA69CB5BBDA1671034E4124B6A75F789F704E273337CF24203845E67CC46873095F04E2097F186E274C9ECD884D5658A8D02E3E2D2735B6EC2639B108A741BCE055D3801299B624479C4BF778DD9CFE4ADDCD546C4FF4F2C3312B5562F035474BFF99F4736B268B236D4E309D21F39D948649896E77B4FA975E32DFB2EAE08A37D6156E14C8CFAB816914458551FFD2290941B11F2FC2C0BBCEE3072F0A52AFE59718AAE6E95FD746C51577E68A806> >>stream q 2.8346 0 0 -2.8346 -1026.2656 2219.6904 cm 38.5031 0 0 8.2031 378.9137 621.2450 cm /IMA0 Do Q endstream endobj 24 0 obj 116 endobj 26 0 obj <> stream xZk vu r7u-vR 3S'?:C/ R E@V- [`Q4Zݭ# Y@9: #M(2eċ? ) lL4bĕd3fW!#BEE<ZfCy5O!c?ڧCPn):F;d;HJ`> Y{!`-3X %`s҄ΚX~}5EL S{\ urϨD+;dX+a[;0&~/}Kwk[FW3roDez'-UY0Q\q4G* j]*\iWF GY Ⱦj9FB}%im!k,3xzƨ8WYZ^A(g)T9#5B7!;/$۴(W]ߋ*ẂMuv@\EH^l=Upn#f<m2CY9/CVxeKZx }}/ø \ WjWKwh/?2êV% _:JѧwIZ }YdzU endstream endobj endobj 30 0 obj 1121 endobj 7 0 obj << /Type /ExtGState /SMask /None /AIS false /CA 1 /BM /Normal /OP false /op false /SA true /OPM 1 /ca 1 >> endobj 18 0 obj << /Type /ExtGState /SMask /None /AIS false /CA 1 /BM /Normal /OP true /op true /SA true /OPM 1 /ca 1 >> endobj 11 0 obj << /Type /Font /Name /TT1 /Encoding /Identity-H /BaseFont /ODLZAF+FZDHTJW--GB1-0 /Subtype /Type0 /DescendantFonts [ 31 0 R ] /ToUnicode 33 0 R >> endobj 31 0 obj << /Type /Font /Subtype /CIDFontType2 /BaseFont /#4F#44#4C#5A#41#46#2B#46#5A#44#48#54#4A#57#2D#2D#47#42#31#2D#30 /CIDSystemInfo << /Ordering(Identity) /Registry(Adobe) /Supplement 4 >> /FontDescriptor 32 0 R /DW 1000 /W [17[555]18[555]19[555]20[555]24[555]699[1000]1053[1000]1081[1000]1248[1000]1277[1000]1290[1000]2289[1000]3040[1000]3108[1000]3119[1000]6380[1000]] >> endobj 33 0 obj << /Length 34 0 R /Filter/FlateDecode >> stream xU;o0=RÍ:`5iwcSb,C|Avwld` w7#N;Iϝ@ur߲2>^ r}8+> endobj 35 0 obj << /Filter /FlateDecode /Length 36 0 R /Length1 37 0 R >> stream xTZٻ7~bLA" X E4(&JҤIͤ'LzfIO&r}zó}Zk]\@$`::m&pd‘+qxJR~ 0lۢ6 h !)9”(??BW~S(tdǒ'O:$ugDEMF;dDg33h拀 u>3&Ͼ# qܟOsH@N+W,D5ꛏKmy@@Dy?kٶ];uҵ[={ӷ_ 2tQ#G3v 'M2u3g͞3w -^t+W^v 7mŀ!P<O@%1r, ɡBכ??RԴt_3jϗL@V6Fg0m50bϟnD@> O/o_"""D :b}Ė".E\q#Vĝ66ImN9iG<6--8oTAQâFMhd#GG#WQc'EO$z}hBtF221Ɯsf̟cۏ]>v>`fL9vFggW7c0`, L, ,ˁU@P ځp'p <"&Xl>~~~6"@A@C@Qh8$tLl\|B*ZAXDȠL @BP1$*@ 9H ҂ rC!pb11I)cqcs-VLc˘1c;{GWׂ77Xp<Ɓ 0fBp1X` [.p |;(,OEm]c3 k[wH$#3;7dd$ 222 222    I $H$ )!b nHr  vvNN..nP(EA$h*4e@Y\h-C%*jz jڡߠGW7 зX[X{XgXH(4LbRr*Zz&X CpdX0.Š`0)l;LSô03 | l7l(*: wwGG''gg×WW7cp< Np<K x%\ pwwO &s+[{G؈N]c{;"vt)3cg΍](vY,0EbcɱYؼآXOc^0qob~mFEGtF E@BLDLGB,B,E,GDClDD"AD#(  C!J;jaCND-"v#@Axxxxk!K\^q 7:nb9qā`qqq8B9.?'++;w1jq/^ǽ 999999 9 99 B?X$I@ґL$)DېDA{ǑgW7w&sgWds|D|?*~L/_6~c<<>>OOωύ/ww?$TKW߈ Q|Cgo:% H0;a^pabc;c{`{ccaaGb'aa`caWa7a`c,M&c)L, n`b[aX-ր5aAn~qEU -]}k;엤Iz$K4:i\ҤeI6&mN&II$FRNRIRYRe6ɞJڕt0Hɤ3I$5$OjƵu E&&fVV68.HL ıqy8.NۆہSԸjWs|=C#Ӹ +;:#+;G\3 ;?~~ ~<~~~&~!~ ~~-~>cx< 9xKRv & ~7~/~? (8)/;'6풻&L<4yx$N^$yY!ɰdt2)95O.L%oO%+ud{rm7ygO>|,|K7%?L~@:z&66@0!$$OERbQNk q &. u!u#$# ! # %'M!M# !-$-!-'"%m m&IPR, EJ"Hi$ )D#1H93}^ץoHߜL'҅tItY:ݘHߙ+Pcgϥ~=f_M9;?yy9<<<<<<C$r29I&L2OR\IVd=HZr||||||||\On"?#!%"DPR:PRSzSPPSPQ&QRfQPPRVPVQS6Q@%)X BQ2(t GS )ŔRJREQS3IPݔ)'(g))(7)(() 甗7ϔov^Ծaԑ1 I)iԙԅT FQj:J- Ebjzj5BQTO RwQQPPOPP^^^ޢ>6PPQ?gh)GF2dL˘1+cnҌu2de2 b5#;fgeh2@o{2~8q*Rƽ2{e9'sALP&:deer3 3eenϔe*3L_f sO?2Ofμy;.q2?f~9gVYfȚ&kc,`* E͢erf egUf) Y5Y@ά=YdϺu?>1eògO̞=#{A%˲goɆdf#1ٸlRvjvFvv6#;7-.ɖdgog=GOfϾ})z{dAuu E&ӦffЖѶbhQh|&Jhe i4;I]}iGhihi7ihiF _Hz{zgzOz4},}<}"}2}*}:}.}1}NGQt BϤ<.R{w WwfF[F7FF/F`P,|"RrzfcDF#Ag Q(glgT2 C02, c'c 461dcvfvedcbaF1cSәs󙋙˙[0f,D3tf0|)f0˘LS43k~fyyyyyyyyyYǬgb|6SNn9srsLș3-g~œ9+rV$s9)9v70,g{!:ǒcqr99r9s=NΣƜ'9/s|jǚšΚZZZZZbXȢrXy,Uƪ``)XedXdadfca]`]ed5bc}d}aG۱GgWײ7lƱ 6fsAaS3sK:cv# 5+{. 72}n}s;*wVKr"r3s鹹\anQ8W=W5ZskrݹCgr̽(!E/s9m999]8=8888C89QɜYŜ5u Ɖq8,ǡr9 Np9\N!G‘r8rSqs| g70,"2.#C^׼yF˛7?oEޖo)o-o=o3̃yXG,yb6^9iy&Ws}?xyygyxwo6nQ)Eu M|?S|:?_|1_W|=ȷ}  0($OU ~ #3`````````````" P$A%*( ; FNAPWp@pXpLpBpZpV^T0BV^CK8P8L8^8C8_DV"(a/LRYB)d s|aTX& B( pA\ZM\صWa G,\pUBd!000^)/,,j ͅ5Bo= O^(\xN'_ *_4hBE"XQ|WD.e$E;E"GW[ޢߋ(:StJ͢EuE,zW uu    MM--mmEPBaEU)|@T(JD\Ո"( )+: ]t\tFtYt[t_T/z*z),!wGg׈ab)&Sd1U) |qX,.K2F\-6b'%/>">.>%>/$*)׋oğ?w.YܧxH1œ.[xu1X).( -T|V{ŏ*~ öoco۶mGI%r[xɟ%OJ;+Wt]ͥR\iz)4_ZXT!!JВd I.H2%9PR"TJ')-+/9$9*9.9+SrQr]r[R'y,i<||/kWֹkYe#FM,\6lFٜeKV.T)CR(eee2fY^YALT&-,Ӕ\e2޲%r}^,V`c'ϗ_,Z~ayCߖ..m/"&-+ "NΕΗ..nBq)^JHRt+HitJ**jVjZK&'=(=,=&=!=-(,.+}(m>~hSѶbPQ*fT,XU"R@W**슂 QEqb{TT[qtş+lo/^䎥;v8ZJieUxK7++T Q5jf⪕U6VU*JYUPꇬllll,Z6Q6U6WD\RAE#dN,KeٲYL,+IdRYL)l2, MGvPvXvBvJT>\>Q>E>]>S@Tʑ9Zr)ϓKvy\!7Mr-QBVAM!QT(* E¦8S4)){**JV(s[AQ)ݟ+z]~~>J____RZo/Ջ՗Lym5b q Ȇh8p Gh8pqLq'4Nl8qJig4l8qNy4.l\ԸqIe?cϸm5Ɲ5}?stƳ7xbˍW6^kxfۍw6kkg~46767E4iljԮ}SM:7uiԭ{S?fX݌n~Dr&s_?"mD۞ag543Ί9RB:.zj찳bagŎ19>̘cۅ0L_18(  Nlq%!g]cq@TY3*+ Nxx xxxx| | Y;AAAZ9␳n 9+;kb8|$Wg\ڐ: :v&ЋV5:&f|g]9Y1Vj 9ް6<;k.;+340RvpX V v=}!g=>>  i vI)!g YY 8+Yrqϐv!gjqХag]BPxYPbYP4'Bh1VC-Кg= =rk:#h=+, k   [Y7b`XBf0N`a0%L 3!g (8,:& [Y;{5:Sκ 5'p<΅ΪkGgwB +ccv9Qb'h嬛ca[[g{7쬯c~DGt ;xd,ĂVκ@ć5%LG #rVwY #.! n "ZSYQus+gMˏ㆝u{2NW>Wgrq )!g\\\\܄"HXҐL$ Cu;RrVYYO#/ #o!Y#[9눰hZ9+=쬪xG?쬇q-M@$`p g&D %ag' ބ@ GR݄ Y;oYQ[u>j j= vV, ",UĨRUQv3쬻ᬏ[9k8 Sg'.I\YY&>HO|2Mt@EDEOA@C/BDFoFBΚ9k.-D;JC[Bκ}} }~@Attnq!1 ag]vVI$5CdbQY-9~S?10w1C ;;rEeM$lFYY[- ; zÞnq;:l-s }RǤn!g4*i:+ojk嬧.⬝qpq#p#q: 7  ;+8!W©pzWsu_Y..pq7o|ÏO 9J&<'3!gKe-Zmxދwz⛓%wI'yH䨐Nn嬫ᬬd~0Y\\⬮jBz_u*a6a>aa)a a}Y!gM$DBz+g-!HΪ9Y==Ä?g BZOxNr6agNr1qag⬛ "gDߜUFmvYog% u 9k_ubYgu%i-i=i3 vV4@J!QH찳Y$IC&YH6&yHNa?I7HwZ9+[wRsJ)C?RfKY!gR~qVqF8Ō{3^fgfd2BΚYYrLe&r]29데6d>kqN!g50klִ8+17gUdWYg ;Ϳ8kR61;5rVvv~0{[=߲g>Yg7e? M;5~_̯ׄBzo!*.%+ ,'rYag]+ `xZ8n(ꐳY'ׂO!gv 9P萳.;+2!geU$,nqSs ag>/:p^sVva~0갳ֶ8Y8kzYEBΪ)2ي\E`Y*:_tF{!g}QSYۈ:zuߜuh/ΊoqVguYO.lqagM[u'g=,>v+:CqS+g]<([9+g=\||+grVC_dŒgKG(]IiRVY:L2RIbYiD(Yag=(Cr\rFr^rQrMrKrWH$yv֏!gvaee&M 9낲%eV+\g-;YrIr]Y 9GO/P~F˛_cw)@IMCW_:X:L:V:E:G:_HT" )B Ņ"KJ qVcYk 9ޖ>6r-Y75""\AWl ;kIBUQ]pWCzpJe W+oW6V~V5j|쪥U6TmJJ9kS @QW6H6T6B623ddd+eed12XYd2RY°*e_uwQ)ٰ6CYnprHbCJk ' TQء)T ➢1쬰te2OY*)%򐳒U4PMUT*ʫ-䬿_:" _)Ԕh$R4N[9y[[סuxQu|HW9빰ՅIYK1@~ֲ".cWg%MYZ19;k{͵͢f^39ji577n<5?l?f>~շv}pߺ{]g3I]׹c]Ⱥ6u{_}ޓ{]w;uwɺ3N_oۢ/xڋҋ ߂;/ z3ڃ5h `uPAMPTAypG"XAV0' ҃`f0#H ӂ > &1At0!D 4 `TpDpxphpHppp`oOG{KcC}]mMxxh < \\ \ \ \ \ 88888|o68@M@y2PJ@Q ? dȁ1666V#}=]]ocC}A{~m~u~_W /~_~g~'?O'q~?я~~??o}}{{{{k=];; >|zΧi|J'U*};|}>'J|"_Ox\˗cl_/G|I>/>6666VVVVfff&F|#|}}|}||=}=|}}|}||moޯOw޷޿//M#]m-5UyIQCރ=ޝޠ7{}^z^WUz^[-{"rlo7KRdo7KXoExcp/ B1^wwwwwwwwwwwwwwwww7;mi||<<<\xc<*#Ty{S< O'CzHI`u68w77眧''88;98N4;MjsV:˜"'u9s 'Isf:ӝxg:7;79;988';;88^877W'G;:8v:Zas!u9J[y#v0 ͑pPّ;ЎDrlpsrsuLqLvLtsvrD9F8;9:;88z;z:z8;:8;"o_ڟٟڟY`ldo߳߶߲ߴ_____a?`om}vحvnZʮUv.طB;߾β3 ;N)vo({=Ύڡv}}}}}}}}}}}}}}}}}}}=>>>>YK͇w5ok^ܭZsrͥ 5j9X&Phk5QMa Q]C!אj5u5Kk̫[3fVi5Sk&L_3&fXКA5kUӹcMv55fWGk+s3[O9Yiq1a>.[l^Yl&ަiljVn+ضDBV`rmLFl [d#dޖdжDʆ`6-ƶŶֶƶڶ̶Ķ666666666eanl`oibdh`kgkknfl}g}n}fm޳^^^ZVl5Y:*VY++͚n%Zp+ [k+˭ˬ sӬ㭃}=ݭݬ]mϖ7זgG{[˖K s3c#Öݖ],ARkqYb,*",UEb)l,B³l- KdY-H ܲȲ22222222222003562073e~a~n~bn4כoo/ϙϚϘOO01n>de25fj6fYk֘+;2\j.1f9L3gflN7S)f9 7̛+K͋3ScCC}}=]̝̑ϦOLoL/LOMǦGk˦3S#C&n,&d0iL*´Ta*3IL7qM&)۔eȦ4Ʉ3ś83MLLL3LMcMM}M}LL]MMLmWPAgOW>Zzojw\=zZQêU_ݷc5d|l|h32^262162516fi =Fl4 FQea,3J(2 |#5s,#H7ftchD#ʘ`Dc0#1uUƕƥƅ9ƙƩ qƱ1Qhcqqqqqq100|3|5|2|4735excxmxnxfxjxbh4n..NN016n8hokm<`6 ޠ5h Pe4Tr 0 U>Y>Q>A>^>N>F>Z%$ +#!*$o/o+}=5eeu;Ksc#e{e~KierY$K@-Ͳ ue/(׮}}2NLOl!BaGg@O9.^/" nrQQP (x݅ܪzƫ?ɗU}WZUge3߿t_k?qؾ?{aO}?wǾo׾+ߩ<^yTn\WrMʞʕ+*+W.\ZrqeGʖɕ*+*GWWVWVVVT,,,̩̪̬LLtT+Mt%UIVbP%Xi5wow>pqrmܯ_vqv>~I^>uܼsoqovܬuܷ77׻W 7; yYvws׸UJ].v.w;ŝNr'n6q7ܠ+לW?8w~9<|JuCʋ ]9rGXNH9Xc˥K/+(TJ*}ݥ>Tzw;Ko/UJnRukKW.+]ZY:tzi[ikqK&x?/X|twOU|犟-_w?VH,ۊo/ őbxKq8P/Zx]5ūW,^QxaqgqGm-œ'7)/,Q\V)V\R<8888\l,b.Pe g O[VW /|`ᓅ,; Bpka-  7 7)\]peawŅ *pjq k + =C K ]9iɅBc!]?2їG>GG={kG3{Fw^4zyg:im4qnƭzڭ#gF>=ȧF侑O;|p#c22:r[Fnv䚑G.4|3OA{#_ߟ7K}ߝ#;o˻y'_ߚo[7_ߓ8Q~Gysgoooɟ?1l~e~E~Y'w__oϷp>8|p-ÛO>uᓇO>në>bxC/^;Grw>{_=;rޕ{{ns܍ksW.];7-%wZ܉McsGʭ--ssss3rrrx."[Ne-7yu7v󄛓CzC ;tCg 9tCۇ m2y贡SN:y褡N4qhme~7ogfk/g>|sf?}0{X#g?}ٷege+rfߒ!{]U=+e/ʞݞݜ=%{Rq c벫Gfgeedefgffh6 eo7 >30o~m_|d}`a0=L&ヱ <=<1p8g쁳8cm[ l8n`Coo[u/¦Wf'o?c_?Jsc?/Moo}|c{{彏}x~q~f{{{n컡諭=}W]wYߥ}]澝};޷Ծ6[ݷoQ}]}3MkkkkK%}>{_yz='{z{7綞wsGϻ{c3L@s3?ͼy13/e^Όf b)gde3LOfYfyfȆ̪23k2k323Ggl9.1s|fS̉2'w@˱g~_u7ݿ]JIό_=ߘ4<4(n>x}>x}>x}>x"$RBdLO04+vh}ȕRe[ULOO{WOCt]Ѵz6ԯ YRxLל`H zڃ"иVZZ|]b X&Ĭ@jYk7A2ui".:ǰ)NM<'e0aNKrX dk˷bY7m ._TL)r.b/5+=_W N*ڃ{+r虳~>x@Dl\~OHGw|^< L'⪩b/_GUf1QQXd=k±ԤHifuQQg]m KU Es< }e'$bɎ?|.|U#Mlʟ>U4E} 5맥CsÍAHI' Ÿ;Jq_nE񠈎Ӯ:?>HLQcX4`QoK]&'y1 ZK( J_JԨϬd',l3FX8 ]6i]DsK8~A:>'z~:Q_w5w;718%;+ս- %%u,T~|iA 7as_CHAXѱxWսTw)KOo3=ܧ=3]Fz:D9ޥ)\N-}6Վdžiuj_ -7)oSozvSߠyZ8vcuv(YIc^zͅ1g3k~UlRp .2Uo޳ֽ XEϷA]<_m ͽ,PA C"ךHs)?(QRLRh8MM 0Ѵm4N2 Mq <[bi8Vls?G0|Ҝ2!v!l}YxM9 6sޔ]ca4?*b1u7Z/P-mR>MShyNӮk וkLۇ| ι/Ѝ$SVzve枆 a Û)9.g yZLw /gC8Oӆwi@^ox0\_OWԡoy~ AI0tSr3q)m扖=r]-m ӲaƺI빖emg ǚưg,6mhεigt[ZZ$͸k08"/Q)a,5miK[L}}lh >sХjM멦e' ?4 =֤M҆}ax8h3[ 6sd0Z CC:Яۊs˞ rԛjw̳fLְ.am53Lqmer)mLY $s'z [b_d5f֛n9n!]Twy6ӌCJޡij͘' SjCss TWo6e!)/S^ӽΌuM*gh5Mme^i3nYŴi'jhmM0FS'j npÿL{ie @n᧒4b kQ&De\o l@v_n bQny`3/CuAn}wa*q4hm&h"ֽ]S9#!!|*:R*ǔ._/ZvC5:lq};ZǔUMVT}ISfj3Rme$2y2 #m#c0GmKu9L!۰ 5Γ`o M=ǖ-TzjM99mQYoG6/X'8hyCr|>"5N8FGLs2oys,r!,h  c ]f:ߪM@JXx?M > C8i18܉sU?nᇜz1V{T/9ǹ)YH[e1F"|v۬7mAXb>[W!:8PG}r9ŖFs2l l9b։ا'^"D._I5穰w#` yR`2ƩЎ˞Ø`0,V T@γ8,1 aO8NИO,GJ+' [8e&,nr\1c;!*k9qsObVg8dZmaaDLc;rSyvy ٶ#nk>2mk=x}3cnga=KXmqCa1fg[/c}s uu}+h> u:Ixۂ"ֹ\YՏf\ט[yXv [, ,W)tB^Ƽڱ^fZv0sO3 G'v-9r*92rc^f. {/p^zh] n6b[mO9gؗpl~"E;.xuʎ8nbCR8?` ֶm{f[~:>ט' Ykye3(kc@{GP jն΍YxO -L{DƭcQE‘) +,\}YuYfyOJemm澽D@9NN=G~{윈cs戬ձ M}L&d-E(ϼr3%<6/@𿜫13ϓ^1nIQ*g,{Ίa9̞K@*<q|3Ȏ1i*y3]^{Fy/Wv?xM؟A8^C{^ y.★m=P/B;z Q]<N;A־ODs}7lnp^zj늝[߷}ȬvIYky0||ۆz1'zQz~D_8Žc#.5+^'a[Xp<űӃvs[V;kluKDj"!y|[w̓z9sj1[Ƙ3Y=}iƏgXf2 mm{!t1%k}|5{ن"aPmc0dkF=Ŷ 2s,؛ [a/@aT?np깭yr|=\{6&}愰Gƚ9#d^/rkն1H Zmݱmϓp^mum8xV1tz g s}wGeCz9E334a>Oǩ 3h:nTV?['ao.{y=[ y/uZV| Gmt;SXvris%֛[qqUL~/Fẹ;`ͶLj]8~5mFdwYc#8dUΑ;@fxbԄus >Lp]KD 0. #ֹe?vc93V^t>zLf^a Z]^?`/MnuNr ߵytg{8v }ě+ĩ}B{.,l@˘ms;߬ O#8|y`M\9"8m8 AČ9~LS n`{pg  ;_a:~Y =grldzmZx. 3^Cl@ϡp{sq f<oe'ZYZcun1]}dtcp^mE >q$Nv&l Yl{r,;\)‰:*Îb+lk!FaQz}<碰Ӕec鸅19&<%J#^ .ל@Q=1%Awy< scb~cʱNB]<c= D(q "gtc;3Lu1v,gyLSA0c#΁ 7{d[ *g-V}9#B<_cOKSv,6T5!<ƈDž}ev1}?? q2'3s|{|6<q󺘅ێl>#;3Sc\d$X1?cc{:Q=v!Y/ k3{N1AmZ@ Њ< Ӳgn>luyLlq:O*49ώ[0p8>Fcsl9G߹O9㓶'ێy3y,@w+cJȐL!ؾ{yŶ|L|b,1v1.;|zaF엛m'rA733+;v]v~ЎXgs [kױs\ߞ/c3ޤnŞ{e`_`{4d>ܘUt zAY?la8s]>mg{j 60?`y)8յm_>5G!a}|"B[^9q{8˔}Od@ B_g|iTq0<φ@h1'2~=DuWDs\$i Ieaܼ>Ʋ|7Je @.8˄V=#]M Sc{~Y_? C̖qֵ;/au3iiNQκHߠߞY||Ԕ^d-=70 ^^C_7 X> n{?(}svʶ 47P[a:"6!t0߸ '6- Ez^lxGD2u6cN W"֛Om}2 |{]6l;pC-ǽv}y9?>8g$c1y;Ǚ<`Op U;~-Ioځ-帿Ui泝{d"1gcq3TLX9s> 14wϸM Gֲm5k ?C~a8N plqdIP=ƍ?LetmǿUV _r~bw?U z>km#u3${zyeyŬ#ZWs[Y?YG֑iՎ <ߣG ڰ Z!fm{ {WT~ y1[q+bzx'-||d9t ǩv6V!aX_A-lݞd9 ց.}jRy5\ z n\-nӰ)ǿUgtxw!޻1w |{ | F 2.3p3 Z ޅw ^VYaRC0YQ$蝒/U Rtm퀾 ݙgcn6j 't4wiY%ZL;g͸5ti`1<_#O~O{RS0sСʜixm@5c>WN'Vq/vC=r yδ9LVezvSS_i[x96DKJ6ў{i2SVp Vzxx?xxwwkoxxxx?xxxCC<<<<<<<<<<<<!<<<<<< R)9,G |o!?"}"$s$*ٜ7syP$<$= DFs):͹O9egA<(&3yHV9WW̹ sXk2~ߑ\m4 Ts._7\~=s=]k勗._3֟w].9Sw^xͥ1EWѽ/YݼqۢE.]d uۙv擟~Ob-7(b!)n\#.W#S=6Vr*?Oۥ.Ո.;F!֫'Ǫ"V,ĩBRlu֊^r) *9(Uf:.QL;_M'7)id/~r[G endstream endobj 36 0 obj 28735 endobj 37 0 obj 96248 endobj 14 0 obj << /Type /Font /Name /TT2 /Encoding /Identity-H /BaseFont /ODLZAF+FZZYJW--GB1-0 /Subtype /Type0 /DescendantFonts [ 38 0 R ] /ToUnicode 40 0 R >> endobj 38 0 obj << /Type /Font /Subtype /CIDFontType2 /BaseFont /#4F#44#4C#5A#41#46#2B#46#5A#5A#59#4A#57#2D#2D#47#42#31#2D#30 /CIDSystemInfo << /Ordering(Identity) /Registry(Adobe) /Supplement 4 >> /FontDescriptor 39 0 R /DW 1000 /W [1292[1000]2995[1000]6227[1000]6868[1000]7219[1000]] >> endobj 40 0 obj << /Length 41 0 R /Filter/FlateDecode >> stream xUPMk0 wl!~l AUܒZ2 J_3[> endobj 42 0 obj << /Filter /FlateDecode /Length 43 0 R /Length1 44 0 R >> stream xTZٻ7~bLA" X E4(&JҤIͤ'LzfIO&r}zsl:pX tp 贙 G~y)I;?#/{o"xDIben"2EM"223h拀]/*3&Ͼ# qܟwsH@N+W,D5ꛏKm6P}h/&m:vܥk=zݧoX ,V@5h}3:`=  u EA@@A3AAsAA AK@@kA`aA "2At* AŠTU 5H 2L vN.nn@@@ W7O/1bz38fḧ1cc&LY8fi̪1c@1T !Éƈc$1K=g̵[11/cƼ   ^^ c`&STp ` x;XV5`l.S?w/o!ΐސ!a(h$Tt,"*FBP4$ B i H6d+‡!Rb!!S3 Kk:ck( ::: :: :::   Bh<MtheAsP>Z @ &jB^^ބކއ6@B?C"`maaa}``C`#a```3as` `aKaa`kaa`10$ aDX c¸0>L+¤0L 07ݰ}#S[:SK[wX3< >  _ ___ _ Q$8 Y\/+p%\ mp< ???? ?7o?b#b;v;0vHѱbΌ;7vAeXX,2M%f2cbbcwĚb=bǞ{=vDZb_ľ}%111 111 F Id 24D"Q(E@f aG8?"؍q'*.>1 { M\.qz7B#ϑ_?0~h|T1gώ8~yx\<)>->'>7 ~{:;`Sg/_#NG OſI0 afy  L1!-@K`$&lM%&'&'HJ%X ބ$J8p"l… u ^&NЌ@EGuF@BG D F CEƠơ&ffV֠6(8 BPxB P|%AU*Q eGQ>Tuuuuuu uՀjB=E@F}ML=ob!G'K85qvuSɉD~2Q+Xۉ&>I|*]Ht{tGtWt/t08T |Jf4Fqh:fh!Z.AWhZ6mh7:ރ>>nB?ECDtt Daa&b`af`bccb0PL&$c4 ar0lL)Ĕb*15 sss ss ssӈyyyym]]]݄݂Bpl<6`34,[bvl%VUcXքbknDZgW7wO_"'uJ/ipRTqI%Oژ9 N'%&R2I9I%IeII${+iW#I'$]JԐ>777[[ۀ`8\#2q48!nnNSq\ ΅vN.ppOppoppq6N^!1Ii%U <$|*9x.߆/K2o_S Kk{Gߓ$K3o#&OL<;yae+'oL$ÒɤdJrn2?0Y=YL%ɵɻ&O=H/%H0qr@DMHCDFKX@XDXFXC@LX@@"L$dPJ J' `'8 npppp':>! # @$'v&v% #"#FgWW7AD1!&Db 1H'sD>QHKD9QK!=ăěĻk;Gg7ԅԍԓԏ4444444444&AI$)D (L H$IHI%$) H:d!Ր$7K vnIOHIoHHS)RH'e@ʰ)Sf,HY6ec` 8BOIRRSvSSjR)ޔ@ΔSJ9r.RՔ)R:}\y ӗJ_!}s:2NKK%;etc#}gCGҏI?g?K6}n^!hhDtL|J:Fr NF4r&9L'3lr>Y@."KRr%YIVd#Fvk!1iYum=#r=AiK@JNM@BNCGDJECY@YJYAYEYODQ`x `)x Fɠ),JO)SJ)e JEM1R'CSvRvS~\\ܤܣ<<4PS^RPR>R>SQQ;SS{QRPSQGRP'P'QPQgRgSSRWST5GMbT**QRT FuP=T?5HEG=@=B=A=Czzzz@}B}G&}F22FgLʘ1-cFƬK3elؒ@g2Ԍ z+#7#/CQQ0f2e=HƩK2d9$sT3ALJff&3,ܖY=Sfz2}=2jƬYg=1{rًd/^%NNdI٩ٌl^0$[]=[fd>}>B7e?~.S7Z-֙֝և66MCLJAM[@[FBAhFeiBVL+*h2U4'K v~]ݤݣݧiOh/h#=Ct8AG1t =Cϧ^B/Kn_ߡߣߧ?7_?қm=}C#cSsKk bilf0"F Qɐ3T -Ȱ0\=cӌsKkی{nj&3;g7f3َُٕٙٓ99ŌfeNbNaNgag.f.gbna˜L3әLgBY,cV0w0eL%̬eA!qIi% mf3GNDNۜN9]r Ήʉ3!gJδ9 sY.!s9ܜœ9K-Ǒrv9s(\;9rssy! 7/k k0kkkkkk k:k6k1k)k9k kk3 ȊaAXV"aDbV`iXzebYX6Vuuuuuuuzn͞^^^^l,&Sve؅mrmcهOϰϱ/o؏ٍ'gO﹀]r;8wxnTYr.]6̥rE\I\E6אkͭurɽ{3~܆r~mtt Dqrs&srfpfqsrsrpq6p6s 'I$r0896p9 Gʩ9ZN5qݜܘ[SKG7Ώy]z7.oby[y[U)yy}ykN:m+ukVE+@*TУ`X܂ V) 0jAv]_+VPZPVPY* o`OC .8[pj O ^)x[mʍFs'rgpgqsqpqWqrp!\7Mfq\!W-rwpe\W˭ZN{Gǹ׹wO/6μɼi<0΋ayʣxtyx xV^ =5^~{{GGgW77A8~<Og\~~9;_|#=?W7w gW7wN^~)iłUu &@ `HP,((N`8A^a1 iY+kzS_ςa[a{aa/@0x |Z!XIB0UHf iB%RaP.T 5B# ½C£s‹k»Gsk7asa^} .Q8prU c ”Bz!0PTX^)4: .R|R[w?*n(~V6ۖn[m۶%JƖK%oޒ%<)X:t^uJ7KKq饴R~iaRd$F+AK%$I"ɔHxBIBR)KLddddOEumI䱤I\JV^U]Y粮e=(U6lrٴes-)[YlS YF,K-ee˘eyee2QLS+sye{ΗWkr{W[Gʏ,?_~j _.[tt4Z:V:M:W:_XTRZNE Ix)A"JҭRT KK*\ZIj:.OtILBJNIMEۊA+FULQbUڊ H"]AH WdW+ * +D SSboʼnV\l{;HQkK++U+/UެR5jDتUVVXBVa(U*fUAճ޲ahDT\rJY .Kad8Y,MFerdE2D&Ie2L#ɼ7Aa )ٟKWϲy[y'yyyPpDtLR9T+Gh9NNrA(}~~~~~~~Kj^T//V_3Hom@45 P?s`á7ih1c5o8qR)S5No8qV9s5o\иqQ%Kg?Oo 4w6ָg̩Ӎg6k>p֊HS/m{u`А ;+vdHi 9ѳΊN;>00?3cΏmrVv;N3}tv3`$'p 0888YupQ!g ;X**h:~N^!)9Ee]#`)5/gMMk嬋Cκ%>  A_rjC4<:NY@/Z9kװ ;똘1[u]`+gepb[9-{<κ >쬰VΚ0\KU`%XrV3 w8L;+[{'p3=3YC&Au.d dd#d3$oΚ⬼gBj >Y?C~@ۅtt4Y@uC!gEC!gBiМ ВVZ @kZ0dYAoC렏MЯX$=#+llll,lll6l>lQ+gA` -Κc8-Z+mU”0-5vC㰳받;z _/o!gmv谳N ;R *Zx rdx g9|8. ;__ 9#x)~v=cGŎ;n"ΚrVNlal?Vݰ}9;"1 Z9fr֔2Q؎P# kYag=88kqOagmFrͭ5=.?vq8]\/_/rPYG#!' ur1rr5rr#a-JC2,V$YrHYYMdm+g=gl#:nhY8kL4I%&2[ H%U`Hp$x $I8rK w$<;gr־!gFnq5(`Y(nmc'$NI$q]gMg >Y7#B===== 9k:;䬹]ކ.G@+m 9NA)VӹY``F``&uAY!8&rT vVbDag8;1`Nab\9S̋qVwlgl7lol_ lvLYaaWrV$6Ò!gea l14*;Bκ{ {Y` gطIIuDҨꬤ9Nv ƍč;,<*:&8D\jㄸb\ qf\ v}!g=;=>#:? ??1 K+kp<rV > 熜U/ŗ8k5ނ]x/> ;}#ΊoNn%Gr!ÓB:dQrErUBκ 9u֩لE5ag5# 魜 ;:g !'\"\ 9k=9CYۄ;OYGDžuvn"_JsVQKrag뿝1}q։!gv֕$`Y$)D!eΚ7gT$ d!H!H;II$ i嬯HoII)R:t9kNH2/eq!gI`C 9kaZS)謯Sާ|nqn!g8k/ΚETE:. ;kܿ84.9ڰBIKҷU!g p^ ;Vڎ܍܃܇<<<<<<<<;k1dAN 'SZ9V2\HK-j"n||*䬗Cz?O/o_%쬃:22#䬋Bκ [9k*JSr*;(VJmYQR΄.~Yr֯!gJIKr(8**gͧ bj?G Rnq!gG}LmYu/κoJY3ex+s/Κ9k~fafqY+3LgYwe=7ڐY;_Y,jVߜU^Wg='7IljYm-d>}2\+gݔ7_?:1111Y71  Y+ C2 ɨefga9땰>d402^2q!hh愐 9R*q֭!g-z,WY;uPΈ9뜐.9kLN|NR!'%'=5GSS;_vð>ogr1 !ggYi-ZrV9KY-zuu?8BRrZz6ˎ9+)9\6-l{ؿr֋ag}n;gmrn⬋~qVfnA U\}%&Y>ʭ9琳FsY8hxuMPY[5_#h8FYfY]:68yyyUyߖ5C#glְnK|9_rV39 iEum=9k````RYg 懝u`$ h^# Cκ]CZ# ~g# ^ >5R^%CCκ8ȰvVκYO /NHX8y YمZGg!gem 9Td+ryag=^t|ѕEEO!gm# &-'v֑s֥u8+Y9"?7g=-O.v6A@{[KScC}u18p?p7p#p=p-p5p%p)p1g|\TdX`w`W`g ڀ;5m@P@E@( E+ @rXXX t t OO~~-~_~_Ww+R_E"_~~OS$?D?Ga~A-M5eyYhH?wwwwwoooo/<>g}:֧)} WmU2W+|>r},_}YLG%оD_ >[[[[[[[[[[[ uuuuu6{x{yz?y?x{yz6yww׼W'Gx{yzx{xwzހy=^5z^WUx{ro[{/ /K4/b^½0/ x-u޵ޥ%9Yީ1Qޑ(0o/oWogoGossgz̞jc[>X[X^[^ZYYZ[YnYnX.[.Y.XYZXNZYX[X[v[vY~-KeqZ̖j,J"TYԲ"- ϲ¶0,gI -p"BLtD8Xh(P KK?KoK/KOKgK'KGKK{K[ \o~l~d~h~`kcminfjh>g>k>c>m>a>n>f>j|y7l7טmfl6fYc40s\ly\3͜i)f9ݜfN5D3 3o2o4o00/5/20O5O4O035513510w3w1w63G>>ޛ210=5՛.ΘN&f̦j1L S$1JLb5lSj"L$oBL4m2-3-20M75 651u3u5u4u0^C/W>]}h;ՖjsicGVGUT=uk+3Scxxxxxxxȸ׸Ǹq1hmFh4Fq(1KbXd,4<#טo5 #ݘa$Ӎ)FoD(ci5ŒP#c7WWWWgg''GQa!Aƾ>ƞƮ.NHc#ቡPoxdocend`8o8k8c8e8ippaaao\`2 z֠1( rCPa "7 |C!2!ېe0P 4o5 02642L7L3L174 7 5 6 4 03240t7t5t1t45D??7W'GzޮjJ/W%mzH_sl=Yzߢ__k}7NOչu.]΢u:FItX'x:euiT].I% -M Ѻ(p]/]O]]g];]wW{ksm^{_{S{M{AmPZ^[-Ҵ-IMb-Z´1-Mڍ uUe%E9Yک)ډ^nHM扦IXHsWsKsMsUsIsAs^sFsZsRs\sT&iƬQjmB@4dj4k4k`- ՚UeEIњ!~>ޚ^Hk+K }=Me%Ey)I~uPmVKB@W\5[Pu:IUchuF!5H ToQoVoRoPWVT/W/S/RSOSOVQVTURPQTPwWwSwUwVwRwTGۨ/OwTU/UTOUOTG:]m-MUE9YI qQêC=]*ʮQT*JTUEBPWqU*PU* B* bT Fb"|\, 4TUjjjjYQNyGyMyEyRyByLyTrr7NeR(JJYܡ,WJJ**ed)JRf(4e2E+1J2QR+ %Yʙʩ)ʉ qʱ1Q!>^.ʶ[k3SEAq_qWqAq\qXW.SaSXZZT(2EB!U+ ت`+2xE(PYIQNFJDP@1_1O1W1G1U1Y1I1A1^1V譈T&9YI q1aA~nyP{NA^%/ 9_'ȳ 9Y.Oʉr/1D9JX9L@fZj* r2RbBTdDx8hy||9<8W'AኀW ^''rޟզzL{?9Upwx9;O?S;xp塿z/=C?9CCrO羗{4];&wUnܾܞs.mmmmmm̭ϝ[[[[[[[;>7?7/7+7=\K9Ws\e4W[~<8<<{G3S#o_ |)bpwp[pkp(?l ` TpC$낫˃˂`G=\l M`C>X, KAw0/ f=Z) j2( J !/w?Oo???=?;~J 2o[sF,L_WK%b|?g3v?o[o?W~?/kUeE#i)I q1Q;޷oz{_>}wiޭ/ϻ]]]];my{y+Ro7f{3o7͛M&x6ūjʽ쟳̾}9ROf>}0_ޙl3ُe?Pl.doΦg^"{yvgsk'fggg'g'dU[WܗgݧݧﻏrwoNsw?~=~=&sSn}{{{ƽڽʽ^vw;E9&w]t' nw;tgǹ)8ޭukj-sKb ΫK s;;q|ѹ͹aNqArs$k+Rg9ys82gYt;;9N3ݙLv&9&֩q*gб?9kC =1=C_kCw];t`蚡C{ ]1{蒡C]0tCMC7n~ 7w a7_}_གྷ ~q;?3x?2}<8x`=e~y2f~q懙524Iy9qt[5ݒnN7ҵtIzlzL(-c_77ۿ____f~}{#woߴn}eK=];o?mQ#[öoc_o/w؛ ZT{^a/O veϱgSIxŮ+ c7]rә7ͻ[o 7 \v`#3'[OXX߶a}ݺU>^.NY>k}uuYZCV>uuug.v[Z[Y֙Zk:Za-m-X,k5ÚjM *ZVQ??gd??ԟwxi߿=wg+.껰wn9}6m[ӷ:eS}T7Փz}SR{S{Rvv.J]:/)1>uzԲTWjnjvjr=UMƦS2%n8v_{}}>އzVj}_꽧Ƀ&$I^ܟ2/yEeKMLnOnKnInN\\\\\LHNI'%ے-d}.Y'cdyRy=uϯz^e =G{~Lzz﹡CG?vG/$^Ltw]z]otǮ?u/]?za;'>>u^{}orE[E[E[E[E[E[E[E[E[E[E[E[E[E[m9xXTqbMMjkOÎp6[f1X^&ZqX+2VV)DF!ڄ,3]Lb6;DScEwEjs8I\1:h.)1IB*K-n.-U T%ɉSe]Yq㛤/eiqHҒU+YEJb&qr׮ehP;@$1*'ÿ1{iL6Y6LYV(u^UPZ!0Lhnja@GwxQ\S:f)jqx1(>YS:Qj!j']xR(-l̄%+/UX!E_u]oWѡ@TT u*KVKp6&<.W0&P,q֥0FQ^jL)[TuuhutPa t4`aI{()clJrv\RTcA@Q6$̻D]TKՊ 4J½UbLZ 5~0TIf2Y_IߜgL&ZU\(XȖ>D.-ƅT"Y/S+#D7l|(Ebrr) UY:O/RG%bV z _#N|ɳ^؟}C]}QS_i70߹h4Qv8(k(5!E&5&EHG !uZ]׋+7GAo!*;~oppbյ{ԼZV=ܣ>ZY&u!u߮Rs1ehQܮG<:Vר_#<;j# GԱۤQxsgF_;|U}+qAͱ}_0-*a(V՘1?gZd+8_A .%l0ڽƵ VhXB7C__ۄgkRZ"wq *x>Qp Nmf{!c(آ8`OZ}L}<[YX-cw{NU0M_PЭ` =b}1(h5+(M47Z)8MDogmB/5m~UH 5~ݺJZ6T д*I~Z4Z5Z[XW-scto5mw>o4_p4Ӵi9ǘCu# p4 qc]q\ƽNӢZ+5::7 ~7/vCנMT 4L% 8dz4#Sض&|#j9bBӮ2M?Y] mT>ysytmƿS C#2A}g{S5B~WkC5m46[i]u)hԴo1~^w Xuz8ͿO2l۪ј-2/q 5fY-pNqZwqiMq7Ѹ5/].Vc O<6|4µF½ZcV`ХXO4^ۭZC)yqN4vYU:!zݾƫgڀo @@0=MÇ:l zTx2/g@& ڀ&ò>̷8A͇qLc4 Wd!}'#hSCׁ+Jjh~mX#b1Nn_!WMs\MHe^^[t[\WAAӰO'Ns|n;SOЛ iz4Sg l52oO8ɼn@1 :myx^B4dRKsCeUҸhXʠG55BbƽjYh?44k4/B|xM4w=e#Gα>Ӊ/,/lac!ˠ7t a6n|U4m OU jּ`|28,?1YStgz C t kI::n&@pߦ,e_+r" ~cmg49/lR81NhոsIֆY0>`^9d :~8,Ͳ^^iEvpN  @_P;a]̃E6BČc'sh:l)& 5dBw{S8{Mΰ3Ug{3\,K?/Fc˜c8cDcbNO=]ǺFWY0>)0&V3^_3s/ y!g{v˷`|9@3z {``#2yl8FG ޲|x ø(3[* ɴدrNʱ!uĈ,;f^>|,LU47zlB_n\B|]9~ 6T Xox\cyZVm\3>` Ԗ3tE(EB1[f]8MMg8,$Ĝr#wXNϲo\pNMQc8m.@&0&x9!Elz jŤS9D,ökvfh[o)j0,,5kBqրyPSڱ bAS4:`yΣcfqCq,8? c{؃W}_:B؆r欤~>˷ ˸G] x9 ˌ WBi|kĈ@r']O;:AO~6Ϯ3pN5+`dL;dx:ͱ4H^j\;e>Ɓ0ﰯA-bͶk|žrK\=Ƅ]qn,\\WGOfP+Qίaͺp: Z) gAYl8W02k]| `AOāq,q;Ő;diZ4|-uq**c9aaKxJC91ۘ1k˾ )w=Zﱭ{^1azA6s,>TJ9??zYfxmxsr xƅΙ> ssnhVA  Ve4>AfwЋ|XӇ'k /6 i>6s|TEs~V RLr}o9(qy1?\ijJqSx4~ f,5ZYH#:RZ(-^~fy։8V;l!nmN<61` wA-iCPkdyfELZI}i ' .4?1_,|GpUct﹙sq-9  ħj2o9|^,0Xoj'wq| hپN+D=ڜA6{˾TܦC{~>ڙuM,^܆q1k=!Fc|~9n2=3MEmQ羠9(טxs@݌ v1bs^'hq lJ]瘐f[cΫY?1v,r=4w8.ฒm! >d 8΄rmqL[i >k8o|O,KȜ{1}"/+e9 d0 > =sq(]b_ ?e߈X?G ~qr<Ќ9G{m?|X|%,sԏa lGAq 8_c?sa _nǤlFfm߬w9z`l17׃1kl?;d26u#q}uXeA3r~~5]reGKq8*ut1 tX9ƄsO{_}I܇+, r}0ǏLgYOٿa.Ie?3wCSl9,&1pYsón>=;ҍ4FB?L7XLp&>"m}X mϓbNgc{e,'#e/hcqk]Y?fyY?!7\ț9p0Zx?9>0Ǹ !?[by%3ny⼽<s |sH嚔_B^d^/c <¸xVb+̏pcj~o 2+9ؠ/nxxUtkЉpV4z{%#~,#?m!o.;\F6멠1W :Pg1mL=|ό#ߚ1+FŹ,?ʼXcE9Ō1|'h j/1Y }+lKQT 7얙r|+ìC`l?q $x7[fcm\dsdcahƟN9`G,,3q,r8jsW!z~ "56p3a6s܈s!Еc ]q}p\ܘc4<%c$Vka1Yw~%h8i c3u/9/-1 |kw鰏`#'Cq:g>rOq峟f}aڛt|^B w9!W6˳NWB_ћ"' _Y砗lPep^w˘OX0~f e ZVѼ昨-aw/x|_~~g'ce,sl6+aDz &Z29b.~yhٰ[)7~z2ɴ\q  Cn¶[9|#!!\'}/Qkya|93`b{,˷qL yAy(&g6,a6MF2Ԏ2'3x~Н'~t8\yOnSpL Oq27N88{&~h  ϱi8wӈ5? |:?k;/`^3uWYhXs|zٮ{ʠ'~ީZ[to4> *sa;`rjcΫa ~3k԰1˻Y`g{QǷf\GP_b ɵ෹x;Y߱X;ohhhhhhhhhh͊ " " " " " " # " " " " " " " " " " " "hGDADA" " " F)D{x\Ԋp[Z]6RT"Q*cP6Xu]q$Vdq:[+rX6>.1>#}\,R}#fbQURc5~}/ڿbテwgN:e5{v?i{̙pSnݻg׹;p]\~~vQr'̙7O]8w93Mλ~ů> endobj 45 0 obj << /Type /Font /Subtype /CIDFontType2 /BaseFont /#4F#44#4C#5A#41#46#2B#46#5A#4C#54#54#48#4B#5F#4E#57#43#4D#2D#2D#47#42#4B#31#2D#30 /CIDSystemInfo << /Ordering(Identity) /Registry(Adobe) /Supplement 4 >> /FontDescriptor 46 0 R /DW 1000 /W [35[840]] >> endobj 47 0 obj << /Length 48 0 R /Filter/FlateDecode >> stream xU?o0w$Í2%YGdwX*g0߾6Mh3,w?csjtzKqr3k+`Z<plwPUy&;^dKCT|J;{#R <)FnW(+h@BDžd 8γ<Ħmi XӤpۑw>ML'~fVj endstream endobj 48 0 obj 218 endobj 46 0 obj << /Type /FontDescriptor /FontName /#4F#44#4C#5A#41#46#2B#46#5A#4C#54#54#48#4B#5F#4E#57#43#4D#2D#2D#47#42#4B#31#2D#30 /Flags 4 /FontBBox [ 0 -355 1227 902 ] /StemV 96 /CapHeight 902 /Ascent 902 /Ascent 902 /Descent 355 /ItalicAngle 0 /FontFile2 49 0 R >> endobj 49 0 obj << /Filter /FlateDecode /Length 50 0 R /Length1 51 0 R >> stream x} ]Wys9{Fo[~id=l ~-˲%,laɒl%n u*m6@CE CV]( !a%@+4gf~}Εe~?ϝ$Iҟ<ԒM|.]6Ŷ[yu?],IyI=y[o&mJ_z={m|`n[K4~Ǧ߲w]96O'I}_ޱ=`߷$fwߺ;>|}_~ٶ{Iק?l7y{~Q+}%]K{gqWо%&yؼ+ɒ6f=NzK{] 3 xYnMɥIs;ɱ&cɎ$ ]|βz!sEH4EZFwOo_fϙ;qYg7GF,[t%K-_Uלw.xk.K^K/[{+_᪫t ƭ۶ߴoz nIoq[wM>v¶&={n#gn{{$[4}[v-]O&| pX '?J~742l0י;̗Wsk72tחgGjZbjק7s5l.j74o^|t6tc䡑wo1:8:<:{ѱe+G/dt赣73z{F7-pf쾱wg쑱O}v/=3EE.Z;^;~wOZzU`;׼#kۚ/yn?c_8zq_~iK^yiKKN: 'oĄ^jCɡI-MmC+kVKUcj44y3cVKi閑{F5^ҙZ:j鼟i]wnYxX2i=c<ZطeNKx6~e;U椖~s9-=8cߝ ZZitK ^:5':{'щ&xbxĿ'6ăl⾉L옸v⼉U+&N|xGO቏YJ >ǎt?ϯ;?qÛ_sx;g3g~rŝ{ι_7cM;^Xcَ;o:̭glqch'ώ_dyv,?H`|ՊCw5]iȡK7ݸ퇚<ؼ&]y -2YpZ:yA'sppp$K6S}5n6m~ۡ?tGFWm>V}VR虢Ұ$[Lu-95Y0I\o6vHt"bȂ+uvk6oJ2}ENdxog/$=p2/IssΩ[s ^u=WeɲyrdEӘUckvIךs{\xr~b۞\$gQw__̓{*{x<'j⃦ib1'H6'6zލ=,OIaϾ?lxG;S҆[n6[Y ~ ۦI6FK6goQ>n˼`e޷{|:aG;/;# ۆLMdpw6k?&=iGlKIVlBllܓ6F^-y }>l-'j2 Y`duS6;lX<16f-xpR}ٝdKβxś,Zf1na `+,V0owJȳ[, eWZ\h:'[]RW׺z-sy4Åy͕b=ZŽޅ ٮԕ>ǥ,\|.xCƥ__BhsŌs:XbW,q=ϕ[jU.|i{UcYN \uN][ 0dq'A~{آˢg53.GhfNwu*htOsz92W\G.qu's+V;E,6{K+"۝nreˀ#,l:^j8ak1A'rCt}ý^38/":wu_opf3է , 48~q(t\T-|kaw)y+7S~^EE-|̔+9 |mpe Y ջ _We__s9y ?4ճ5'Gh4维{9y<\x39/xp|{fxvtr-1-_9^9y랧?qhs\zQkp9NG3NY,'Ӑ|W'ϠE=3S+w /qz]pi '_r8kϙN1ZӲ:]}YT17ZdԸK_bZ Gck\|k\/vRvkk.MUVX]\az) R"<|{A'AwA}25ci"nG#xS_w\\h~>"uu+IvC<=ԮBWci Kߋ] ô(cuNXlVR*SEw>42W_|"\y _'C6Q8v@'LLaanM_[1:I>4CzYɐ]?ιhmC6fv'MI 2>:>mú-Uh>,|erjWFʣS[&eʌ>SReD+9v[L>XIԽ5}@x&9_JOj/ ;9Σ q/MkY 7^s 8π̩ʲmZka%Y3 rSd..>'}]o]9:Ҵ|g۹q3A۽7ô$,{:C:)}pY ZOb8~ґO~)e_xsiofP'(wN4iss[E )f{rg&DApL_f:7h2:v; "'6)#3}>%d߸t)<Яzh7iٰ14An kF]_DRaҷ}~y\.Ӟ 1c.g;P b=5_0˴H@t賏xŸ"զV@k;fѾdE)2|{] j%׵|}}:n8G:_6C}>XLDGik 60lZsBI"E.} \XhI+mZg٨!W731ƒ2 ~ʫP y3|s][Ahf ӥ_K\g@)/$>f.X_SW BA!O4)~y̷Ơp 2kvò+~#RNdDuxG{Azt]`:$4딇]k:O)yz ~#=Mse>I[ʹZtm,װ,g\7lg_ȏ}͞]7;!aO w-~N<5Y-َln22k~'֙>g>ZzIz*v{Ҵ=n/v]=AMϸ}5a__2h>ugR(+c ۵ϟHE9d. F xo(SZ~2x)rΠ!*79>Ӕx,^Cp{%XCɧ7y{udz֮+a۴EpE5:][ޱomu5F[i3mO[{mWWjk>[_k70Ik0%3FK^vƦ5kPfoMVۭgĻJb=5z,fLH%yp~M=5uC0 Sn7r3?k'RJ<ޫ|%"vS%^}9ᱞeW=imLsWnmZ-Nnߗv'ʮDyPVK;Mt4nΏgux{m#=WI]uƳ1QZʹHfˎz{hS r~''R!RwiGhE7oc:l[WgqL+۲b{cȇ |7OA_Vl'5~J/4M^ ͟i>IYm<ӓ<~q]j#4jezn'n;{4HqJ#~gySA\Y82;;3}:'d?@༡y q}v7MnoD)ab cP/gmCҤP<α2Wo;+3L{ö`>*y=Zk70BԗSy.1E;=̴.q_x3=s }4:'Zgiќ aix )BLCƳ !a]Lʹ̢ħ!]٦eo>^D>'02"SNm׋|.Cb`9ʥ aSL!Wu.cJtGj۪a>tE_g8=`́7a<[0zJҧ:m5D^b33pAEE;mZ} 89\["(GdDH#$WhɌXƪ6I^e1/fK!oxYQt_f=+ _BW(,/֋+Br8xHkfz?v4(?HKO~_g[\G>EܯT.7hw9; \KX.Ŷ6l6Whc;j(e}92T}\;B=8gdq]T~4gZ[kveC3]-/c?!7vp-T̹hAG˷ݐk {v\cz`>Gey\G}nxZE܋e/[<'S/Nhv:i::auk%4ڍm'vGdu6?/Tf';^a{k{m[}~Y5?]<*2dJ>Wh˴||Mϩ}m,R6$;轓U өēmLKhxߤB_۲w}k?SH7mB/^ #psy}mΗ׷&)G[[afMqk"^`}y.5Qe_@ǻS#pMwj־ y-ǰ:rhs'z0F[ãl22ٴxԽ@Λte@Ė<3k{&r _-޻S~Ei=T'ƿ snZg~xo0Jċ~R$4Nik䑙}ChucD[Q"m`]2hwLsӮ ׁ'iݛ~܎. erN<;zcYYX_a~-E+2HMƣqXt؏~wjso<)gh项o.䣩ͫˡm}ponYE^m>鶢 ˦# !9BBex四ithgDLڵZBҬb+|>זUlxr6xݵ@~~܎e6w;;|OnOYjNl@Sl_ee['*Phm9H'v׉f]͇kѩnØ_q1JݫUB龌Of|(Kα6g|#/Ca l}a^sy4/)R4qm&rȯW;Oo QoYlS|> Bs*A*9-A|~wrG%n9=ܴ8BȇϨ3*}~z;s]|WP)H-F}fz# irեJ\JOBLGfmBSVo;摙ia޾i|ݵsd~jeߤ/6h4>|z/n]5]>Nl=E\g\練qe=-?\'mZ;;އ⯵+~Ly,c{󵁶W Oc*wMo"7'2|?7t-q}s?fp۰\ aV?LcG>u\Y_,S>{ WW|sXOMks)u<-`}Vo״U|jwWCnS>p~l't2,ߴ{LS; ~Cև6Ny6geiZjckV!}XCa/o}|<7^:/"_;krT7|QL67`}jcth@`Ys_ ٯqjClA%5]ˋ{&qmu'+}4?LwnJ[k)_Zr[TڷeZ+|iy| v:7%.,WhiqMM]x)O^T.zV`=YҾB߅3=o.v/WcJӫey|߭j4z |PþwڼPcs]Dz&ַr/}+8}L;u_f+KζC}[(?O@7l2Y{4^ֿlWWʲq]y _Bt^1Y_SzdO mUqBO&~}Gmɋ<;m1>5[.h΁wf8!{$ oOLk6qxMzG״NBk@Sse:[{=\tO3|W Kf7h~uϿc(|L 4P^.vd~KZFNDZnCX^OaZˡ`a\z )0>yX^Jd3k'emNwoh6 mKSis0K2?32>hz>PΪ2r#UCo'^Gc;ˢ"}n{x_Vkg_[20omZ=on.վkվ٨"ky?'T_lO52=CB|q:S$N2.[P}}zGdcZG2=y4BT_$Ϫ}z=O W" s* OК@2WUVVetFBKx)h0S{CT7UޛE8y4Fmo ^ٗts @Aq|N+r7(o_'c!˄F/Ж}E'a[و6Whd_)MJ~@A\45. / 66ɞi1}Z/3>>oMMֺ'/y8cb(b}[ߙ<!U?Zǜ:># ^?)l(si_3%ǵ2}PvicsBkzZt2hD?|`~Scwǧ -k7#\NqiC kw,'ƱC1bC?q]xmv>5ZMޔʲ}]mRfܯ}}P#NSӳ&o!49_*ދ3sӚnb_1S:<aȇ| ~1L<6\B1;'zZйNDGj  ])g8=wiR#:Zksk+wTT~pJďC]nt;@ zoEr ] [,23$6̶}Qy/+Ws('tWl"#G`$qQoyEehH/RǴ'ۗ}6NG0 /|m񘄾E͞>h~ϰij3:E:s#ds;QޯZ]٣Hi'Z9/} aDXsܴfn!2#zzEWܴ棵; o+0/N=a,˲T _))TU%?k#?c:?4? ;,9JodX26N>U}{T?BkrOhY29zqB'M{oByFHZ>)g8ig쳵sq!xw!4n#>O9I Ck+POZ}}kyBeC6tZV |D*qO):u>?xQhk[m⛧ڃs$Zfvֻܓopk> 9w2;LHd$7|-> Xnצ>@y/٫ ƺ)a#r ܴYA蠭]:ƪ@!eu7ߜhk~hzk[#4=kٯh9LJƓuɒ+qقBl.O,fhiyO~+4孒q*e8ٽm]W(ԓiSߓy -+m-Սw0/M!OC=e^>Utلb~mƼm/ yź;mN4ِ<B Б3Դ/CDu*Is*_@:7F|7O,ۑ*g9'ϕB>p>wRFڡL?ɕ4SpvOqJ>>UQVL;Y}}}eTTdbemЉBeBYU>_kT#וm6GGWWkP;j(Lo3űTG;#=I>|z ə_s hktCettىI.3^f/e,[8^'ber)>?BJu߮ihkfYZ'z5v)kW_D xY^)/3T8<i:h/mT֪!⻶oW*-2Vdm ׸u%}07YQ?)mSՐ{ '%4}ٮ.7kn4I~wnyjrVm?h}Ȫ ]+[&` =lZ۲|w%i]З⚍ ff,#~.ʷD_o ٷ33"6ߵ3oy"h8Rycxm6829@yʠB3yXh"ő}ϮA8U@Ӂy#hymU]DT|LK<pߌkz)'yϺ=uO<Ǖxޟ8| v/h9%ח u-2'7^+3HO:a;uTq-GWζCio8x>&CwnDzS{Vwо/ݷyt*sh]^VlTC=_CuɋEQ\а} 9$:OJ]PfUZӼ\GAڍ&Tr9SJ_;IvVuert g4>W_y{;_V ro|Ҁs^|{&O} 딖y² xg[Re&s E\սToC}r|ΘA^ i =/sKOE}4|uYI92XeVT_%/Ofm;/Wʝf S[`~8K)߱AZȉ)8FFql vH}?js"]ºB/5&8ɲ&tSzr> gq[m' ]giՀ>EW~(O79Ih%lK#?khhSu36@ې:m˅m+Y@85s0ϫ>(Ґ= *Y,3~G gR'|-x8~r~ۈoFq_} Y| +)m%s~^ /.i?9?Y*֩mfRwl˺i_+r::6 ,i?q[Ⱦ}g8އu8qyߪf˂v{[q<~6zLo/ uph9f qX+Y^~jZ}OV1N1-yF{|Dj}@eZ[߲8ޟxiԷ,< ܱOwu>=ô>_oy״|>Rd ]N,q{98{y {-p|)¼2o8{a7ÎgQb5bn-Js-XLUE -9Odb[ar(ʽbB'eWXtsN}79PgQb 8b ^sgl3o\=Ħrzj'ԅW9׻՟<+V;rrF]-Yt=ֺvN"\宭 lq,.qW;lti׺`WM_Iǫ= ;q$ɍ=dUR_0$SEE[LM2׾W\µd4© g߹pJI_IV.ܕ p-Ygpj|مap,J]Z^iA]$gupaKv גjK]8MΪم-\үKk^~=طgo]\{\w}yݷz_W.]+WfMk͹a7nV\vy`k*C˯Z9>nlpTdUcO}GcW藞J.ONIJ$=dqrk$i&k6vlJ3Yos>`ûl~E߆n%ؔl[l|Aqe6du2n{-isnq47Lr9٘lKVؘɕ5 6mߖ8@/B ht{y[9W|kOΚn|t>pM{߻kl[o*O{Y=J']7x<1 endstream endobj 50 0 obj 15091 endobj 51 0 obj 180016 endobj 19 0 obj << /Type /Font /Name /TT4 /Encoding /Identity-H /BaseFont /ODLZAF+FZLTHK_NWCM--GBK1-0 /Subtype /Type0 /DescendantFonts [ 52 0 R ] /ToUnicode 54 0 R >> endobj 52 0 obj << /Type /Font /Subtype /CIDFontType2 /BaseFont /#4F#44#4C#5A#41#46#2B#46#5A#4C#54#48#4B#5F#4E#57#43#4D#2D#2D#47#42#4B#31#2D#30 /CIDSystemInfo << /Ordering(Identity) /Registry(Adobe) /Supplement 4 >> /FontDescriptor 53 0 R /DW 1000 /W [17[641]18[504]20[633]545[1000]850[1000]888[1000]893[1000]958[1000]986[1000]999[1000]1158[1000]1290[1000]1294[1000]1307[1000]1698[1000]1714[1000]1843[1000]1885[1000]1992[1000]2302[1000]2353[1000]2437[1000]3105[1000]3157[1000]3175[1000]3207[1000]3217[1000]3670[1000]4221[1000]4270[1000]4278[1000]4295[1000]4392[1000]4412[1000]4461[1000]4482[1000]5057[1000]5092[1000]5180[1000]5197[1000]5360[1000]5458[1000]5584[1000]6080[1000]6095[1000]6097[1000]6098[1000]6134[1000]6335[1000]6513[1000]6590[1000]6748[1000]6841[1000]6898[1000]6947[1000]7222[1000]7257[1000]7262[1000]7291[1000]7317[1000]7442[1000]7484[1000]7529[1000]7635[1000]7661[1000]7815[1000]8336[1000]8549[1000]8814[1000]8885[1000]10461[1000]10547[1000]10676[1000]10850[1000]11185[1000]11297[1000]12164[1000]12494[1000]12712[1000]12779[1000]13292[1000]13299[1000]13345[1000]13438[1000]13618[1000]14113[1000]15227[1000]15858[1000]16604[1000]16605[1000]16620[1000]16719[1000]17059[1000]17180[1000]17856[1000]17962[1000]18164[1000]18172[1000]18892[1000]19276[1000]19317[1000]19345[1000]19389[1000]19878[1000]21901[1000]21902[1000]] >> endobj 54 0 obj << /Length 55 0 R /Filter/FlateDecode >> stream xUIo6t F ! b'w>G|Od6Xcx9ߚß[z*f9_Z>T/TM>N^ks؜>o5w6ml~y~6o5|yپ?ۗ{y-[#e<ߦkiki?=[.)uA)̓r?778/iB#Q历JZԶ6D1-\:OSO,؞&@+px!5r&@7լ@[)*6} RY3PIVFZի> endobj 56 0 obj << /Filter /FlateDecode /Length 57 0 R /Length1 58 0 R >> stream xyWu/v|gsNϳhVKjͳeY%[my,cv @ $)0 !y@%`rkф@ $Co:Uǒ!?i׮^{Z{00~𡣓3z/^yӉΟx࿆G7<H?ᦋ7?Ocw|}7}? r?ܼނطG<!r{?N q gϗاΟܷ|]8{ܶ/>S _s8~߈0*`+NtXd29ٶjX7[K|  XE3x?(ɊiَA.b\`[3]n6oYغm⎝vٻoǮ:~էN_sK8{}r|Í%+[z[o8OGğps{<wೃ bx7>_1el7;ng_`_deǾ=rC‘S kZ֮Mfkkjjuz~{oi( 6rbh6ZD߸qqsoi7x[[Zw^zC띭o}_n}-B{?MU^?S?zzzxfxfz;g?;GfOɿx߾}O~rO'OOOO埪?5O/>}ǟۗ]RTz/<S 6|~TMD* 3H%'_ʵRiT~7fTA*-Sƍ *]7xO Z[/mG[R ńJ0%NUS[:ΩN3J}[B/T'?ed |Sͧ:OO==|ӷ,'KX-nK/]K-ݻ_:inizi|yCO<}}OKOןG~O_~{OyO|<LJo>x|ǣs[-=~wc_{쓏}?{}ţ>GoԣGGw>:hQ#T)<=_ɗ~~_?_zƇO=|:;r=~SO͟ZsjS#7׏WzU\JGAClT?҃C|k?pDCx oo[=$8{8O|מ8[zaGZ͏j;n]|]'^8VۉeDd{n|vZo{d!8zV2Siɓr8%ܖp[\_Iۇmk>qC/ZXNر8 PCԕ|o,~PhߐMo7U=]|Aiwp[-w"yhSQ贤noБF 4˸ٖV -3 IzE^* 7Fxp\qbq#, A~!:bx<")9E.6Q p.]kԮ0 #59،S/YD5Mo .ےT]6zdkiDSq{qP?|1hDMnq]nL,DE14^2DCf<m$Y9[N`8\S2 > g[s>T휎zRǛ /[f`f(B JR$ͫbk]TWd:53 Dz>LOJ:CHۧ 4/ cq<{A[`4BE@Fl5/\ˆ ڝt"$CcӍY%D]2wCpn\SQ^U$x~dtW^Qpr6j8hGw蚃CwDiЕ4EfBu@i%qbNBIv7If~NGDM T}r/FJONGԼrWZnv1vix6ƺm Y<# Sэ4vYkQk#WɈ1+OElqk*u>2v`-!BeE ra^jNktepi'9a+XatUvPr"߂[* , ^vD >^Z'B3;vǮ#=&v0/7dej4hĜ(^ <{xAml 4.;O9j @`V7*_,"e3ZrT6so(]\?b k`.Hu`dIaSČs+b@4$4'0e8$rb(7xp;U+u$"sk}O#ےsL4L?ʎ˺"?&b`m1C8Kh7(i|J@"uGa,}1T9MDc*x '%r ~x6vq8aǔJ": )IcR:*@~'cad#3(O 0h 2Y(:@ECձLnO*$&^GMW!H~v1N1m@8Fƨ;pۄ"q?W+_c G>{E]0gl02`{/qi;|ֳVA7d.ddWo?M9n*<ی~x?Bx*U-"nق:yp  9_D2rb7ꌛMlYx$E>Ay!"])C')݃2m38w N|P6s%Z@(T&*5 4~1 WN J ,\-ሦsND~sB<3P\ZpGlWUS7'U臚 S *%   N`3Nv ()|؍wwY~Zz&yLFs͉[;<ؒyYGftS ϋChL[kÓZG6XCE定)3jintQ&iU5FLe#̋l)` g6Qǃ!`" %NƘE\R4V>o@BVISZ:`E?z,B vnuD]홧v i ρHD{{ېB@YE&tLUC=_v}H$ǽ{nǍ5%RPvi84YH:_+FU`j˂2<(E cKkm}˞ W$71n[E)E)7Pw0U_66#(Hh{{0B2JoLsbր3b"VT\G uBz;VO18j`)֌(h<0f6^YNҵcFQQ`EN=$HoKӕ@2 AvDl_(0)CiE5-)p=]GAxuAIXj01Ⱥ,T ף;k1#ْV!1GZ1k &A8~<@<0^q 勲\9JPD2xɔ]/~\%j'z$J*V2KLq!WO#:,eIŲurfVIh5Ӕihb $a\'yI"vdY&AeMAQK&G< ;; k~b|yKI`0Cƈk:X_XH+np|laz3;2ϻxG)tF[xPMD\%7 9Q Q8yqk6-pӈ_D^h pggszt|@i[l5]`{Gy<֝X\z7i@-EC/UhiwPD+h2@` ؼDp07|:i.dMSE'Ao ސ5^@mɚAGX͜Љm3pTKGmf_pI[ aa(<(i2V2>aY:H ɻ[xK,)[ۂ%7([6\N]ڼQJPH>[zg=R)MlXtSQ]+jSEy 4lm : cZyG~ "7^'<8*"@+*5Gj0ku!x21O8 X٬w)GiFAB8f4"lvS7Mp\;bϣ w_G36 Y:Waw8t*lT[%6>+Ǽ*F䩄 =H-B8&߶^o!*ђ#-*ӊ?QKY=1/ۘw'wAFQ?n&x)\p4iEWx^ U5UMω!9ua۶։M YUjWUp paViCαg 4v}L#QQ&E9u4 -_q ̡ո!["?9֝+DWfa k@G)CtOڥ(Ilt/ԯ# qCSNb1$cME\9}wzy;l㋰fhY_wD]#̜؜ 0!L^PTf^Z Jޅ-!/& d{gF6fe:>q-Bm?`0 Q9A}jʪ `Uh&*:$s?0.\dgR&ȔrWNQ&ku\#! $~l`BS8@NdW# sz` :c]cp|dÔ{Ks.(0e+oo"&U##qO3ӑvLdln :~ӔߌPG VE26015!D=09 r^Orr 5` "|<ʒ  x=p`HA -^ bcB-" Z!p) !Qq*ĞԿkrR.ۆ76b[nXżU˂9ZcHyQZqϐ,rOw!i(6,.Į.fP>P\C,Bb$vdMB/=L.RͅQDŽ3;r(bqdRviN]1C ܂fE|}00z[BnwŻ[݁RAxΓsysڲQq:oYTCJpa[D 䕽/s`:eԕ÷xDžts8?ylzjڤ+ܭWzխn=7T$0+!!@:Wڥ]^6E6 n3!~ {ց9%1E2/is߈-q잛ȿ0!R Bg--Cބcێedobw~R e H:L(|m˦((-9eˋ$X.6J(Os#jf0aE4_uQuRNb3l˂(D.-jy|pՈ8>4Q *S{hx_EC^ԤF5T% u(:'ST';jlfv|ۭ5RkR4'3s\z?LH!2n 9Fv^uxu /i6724AP™ L/p2lG!7Xkս oFy;)fB26.%"^WG6M"q( rtACCꊴ# |?uS;k "d}s+k]G C(b]:{O)ŕ6KRm׉c%WL^0O7$j({*qni. p;m+؉:M6>b^>R2isA͇ )Aڱ1:9j杛-얩56ںeǮrtT ShDe{I˶:2T"-A{(\"Xe`mrS(DFGa/y 1`~5CIe%˵Qo0e^y /Wk2jAk?^O|5:).D{oߴel)eYo&&c4qecrc>MHxlJi+jc]E~6)<"LZ^4qk bJXG1vU[z܀;Z`3 J+jjCṻ/Tg҉9+ ]٣k;!5` ~=w˼]tP*lTz`S0aqBqQ]nr # LV38Wʉ+Y=F0^ |xpQ;d@΍. O#Cྫྷ<TՁ5: $a4dIؼԜ .ԏ<{n)6oU&Fu=$EibXn{//eZ5VF%'CUU?q1㇛rSVq.Np#*z7v(ZNоUFK.&HhSSUB9qx"Ekܕ+aJiNv{&_ZS̸`ȪSK|G]O^bU)Q4g_Krǡ>^${q{_<¿G ,Hwۃ(]DL}luIϕZJ[A5e[Jvq活%wrt婅sxKa_ͅy[ch V)9_v5BkTGP[si:9*G|b 3Y+k=:냢6Q*nt*7WֿiҘ~8 v=a uT y \Rso:"C%(hҔȾDr J%`6 P1dGllKLܰqixe;GPۖ>DPZz4KH|"=9/E^."_*p!xAFef7S*-f+Loو/`.u#̣e 3UKZE^Rl+*x۽ͩ)Lo&&Ƌ91uq9նQCuA|A=Va1 ݣy~rxݾ5L=vfjfN,JyC^|OsѸ34nmx'` KPWEdzt|1Kb BV*kI0Zަy %/-=Ghjh#'s{|"7Gm$4`/̚O$O3]qX/ kdGzL)iV_3v}bZQ^%A(3aJY|:%dH FX$6E-z:Ū U3އ[Bu$"/8%xmtgI,yلD| (S؈6nzw Z6 W_~kΜ}=7ӗ繢0QWhٴS5Gp*CKg:LNILvzh:U "rj n=㥫A(``i5vavd)-KU$`bJ d3(:B!<ϫs*A.7 ^Q!<  e+/H=#p#ߎ.v•mI_ˇM] .jEǫD>Lf MEl6a[:682F<&FguB{լb;h K8ܳv^Y;pcMG|P@ݫ! a8B L VGO[hQ/z3Y6bsL7}^7fSĺRE'V;**O(7'خ.MSg~Q-h最vh]HUc^`?Cf8A!7W>9'yQT4kFFnlj!BKh-"H/zS-k|XUYE[X+J܆#!k#Tn|3в7 sB۸Z%EIoLf/ kj.Vv/z&o5 ;;a[fsv|FT.U+C¸eG;㐖x%wBq$l25\m8*ϋgJփȲl Kd:`<Ven'd"pRV ɑ8~}ŒҴ ZLX~=>2]!gږ:y]~7P R 0d\N݁зJេ/vsm7ed)_UJ"K#ә^U~ ~y lPꂴ._]SصkR I)/CRd5FbQ蟃Wx  8Hû^( 390oʎ롞G1F x֓[Zث , G,BB"6h IGe ZCeii>YR%dK[ ꬬk#a;K_7Q:nԷ8R\+9"ݫF{EW ^}9'`"疐s7o 1Y\t3c9똎+Ȏ暣VI/v!d9t -L{l;xl]붯5~Z!6?5vwo[ؼz_\H-ʋg g^oȽbQz*DHѬxT04"͋g(TZ [@UD!x Htd|*_tP)ad흁hp2$ E $Ve@TbOBМ4ҳg 6a<8#mח-0k hJĈ*#Z QrV A&8neE@P_*h/sLNhN VȮ뫚 «yu6R k;.ʒ+AN{vTC/M;L5QEԋ|{m:ȱO_א0&Tt&ٱ53 X&4.)u})Hzh>q7$+i\\f*ǂ`86w3FDO_fKHq}^uMHm'["M[{☀=."qTcr|K=p9gOma.&mmE R3OPTXaLw;Q:upVYD/s$Y |Uj^,)GRp[<;6y*@z ȏBy;ITF"4l3#?9;G]N(h}9W (VR1?yִTճb^9Ja(8\H d2GcFB+Z=(! rJ2jm~Vvmk2orm1 oPՠ`fN]ĕ\C iӑ&TdM1oJ`<8^Brz"Z\Fͳmb~uފH̔hFn7WsS`V1M# 5_y9S#GvۏS`<(EBei Hxd0F#(*X*֣c./ݘSdI-W㽻U5e|@utIW=YO8־#r Y-G8P-4El-+i;J4 c _+x4@$qbzcLuQ@$J%ݑּao\  hOUԮ$`x.LR۫oq̩1G7˓(H#ò.}FOI鼼ѓHa8ʣrhUc!8B5 1U o A]X Z[g`}SoU6hJ7)hR9KPԅ3 /@qf`>J8-UdE6Bfd^P43 x4C̋o~{wn3D2{9ѾCE(p *g#4B!9㈔"468D3,gjbjfg绩3<8e'zweV'\$Î@#cIvʫgWb(5LIw%`$vA#:BUQjO p4ȏ`FApQ^66z'|QC45A-D'aʶ][Q /qZ 7jߏ^&2'~?s0roT2ٱ3e&86d8 ͎&X#{%wF-ZZ0TFdQOP_0بrfCM\'lZBH$H}dSnnuDhҮÝoQ/3}M,7<tРo Yyq*L(h0ѼfL'ڎ|#\ %xڌKUlw:q)"|E-ثߟ@cZBWUǒ%@T o@?B$O(P@IގMkA'GVEb$ W r:&y \E\b5w Y75oLɆo{zU|CkOӧlJ7i*HS[jT58}!J Py6+t/:n 3(?Vr\45 ]N-Ȥ4)hwG"G6](sf|hʕ{5ѕ' K Ik֪G0GVī,w"/%qZ#/R2BIJ\5Dt):{&6Rbd考R1Q0d7* - gS9n|i'Nf-<}1bPPLhOAF =׻G=]~i=f35{iJOV<]E+VvCarVJvf깶4qMµ;QO!MmŲ(>YL +2A*Ut=#uuBXF}PTXio&BaR"Epdhd Xg{kVο8T 6RiuwIV D۾bڌB/Ww#JZ1U_sE8XōpQՅU*-fDV-˶vlǦ mdgّYJ *_7O\ |^n@_X bc+B\BAA2h3Gy#Ҕ>%{jl>*h2t[7^.K@b*h *-)Bh^9tSZlAgX+ ZxnGl9ABg`B< /BRd`k.)jgi9^-+xᲈt _ϋyb-h#m(M kWfl'Bo¦u7#t&O?_e,NlOWP'BԳgH;͸)a nR߁߅ލ2A1ixn}C@y/c Fr>a/S]rnÛ|n1ׁ)?Y*c3H?QG j~<>!@՛xA|<زxwߋߌuzw>ǯ? ߈!޻͊.HLbȏܻ)I2[32)8IZ2sޟ$}7cXRd!6y6'ǓDʞKKQIڑߋDrAL1Ǵ L{$mݑkkR&$J@wSdVrB$MIM%SI?PZA}W&nOΤnr-sm1Ck'=0 cHڰ6ybB}%yI ʅ1}0s|%FxxaǕܓ<՘&O9Lͤ=tt/=dROrlTNھ\rfzb MQ: I;m5y6hg:9:}w{I݄y.k$Yf5iԳ7Vde+ɛQ1O;(WBŝ>Ѣд& kVr&4:I Сe$\=Nɳ@r<1xrUI'f%ܖ7T).$y&[[IRr>IܛNʾ+yf:[/LBr9̱9N_'Zr=MRrHR2˙2or72Xә5-;I }L ]'e/SV?mˎ=}oloҳrK?_Fwإil)[зrD-wY*+SRjY.g}\)d+򴔤"[=TXo9ufuVy?fVˠl۲2/g[_X+R2×*_dc}?N.3ei?Z:^ӾVOZ\2b83Nv/I9N,#et<}G}<&g5)le~+ɵ|ΞOq_:daK*le^/}%e,f/.Vgil^nwN64Hݳ3>'ed\z,feif)#ʹ /_zm<~&X4Vsz]{=M}ײOi^"ey&zȟDeO~˶+%s3yRKSzS,ey1m{*.ֶ:k{ks?뛛rk$NlvhRv؍Ʊƍ6um$@QU>DTH"5R()?QT!@G@P$T eO\\_\}w9c9?ku<ցBעlSy6:A?ϵQrT's)4{t}Zt~O|_1̇aiO3]Lm/s?mlslK{lMc݂JwyW|aWm/r~)о`n)'mˉSyr9 ^AH<]Yh꣑ۼN>Zb>Tf8G*[>0)Ɵ[גmD1 Cm7j hs+ñTܷc\A{JM^g%/CKp9wsf*G"n٬η?N25-I҄m0=.[22eٮڇԤg7xz;fe[kW^)_Z;ڑl٦&>! j{e=b/+e\US峾DRrztK:<7$hmlʶ:l<`hNkY{z\4*<'O}xkU6yc弼7PП]9=/(]S6٬lm[oRr~sU\˥kח>T")sc(kߩpm|ǜ|^ww2F8۱V=amm~x}#z#[`oqڏaw}v~p+ɫ5oibsxw(>Y.FcS1kΣkymK}ܲs2<ӱ:|>J=wkDN^Q?s؎YDeEe9ڤt( Ep{~Bi6e >y"Yڐ;49ղ#]͉tuݕs{ʘ0a*h]؝8s6鰑4._ǚ_b[|k*#Ϭ}]dSg,_.%ynlC.ĭ*O++X<W<<`M)/_T^r|TG>ټ\m.#ݻv>.j6[Km 10ׁ;[8W6m]e<#nzM*q?4YmBR/J"ggL;mMIpڹYG-kpr-M4Ϭl˵W!ڥkCv_By1Z〨]鵦tCϵW!;smwIje 8Ǵ1szo?51|5%CbCC5cDC''|w)üoK+cce{pnskbc˱Q|'J{nzCׂԗjy v J3nTˬx5ΙzΥD{_ܹ|`un =e*|3pYfXZ7')~dN|/wxMy"w8ixtu\mY =wA}{H(I /G=yssqz`QeߋoR:[c1BkBw^{D@ ?w![.uװ-]f tyYv$/rBa/pٲ^/߆%[KB*/|ۜhʺ^b{D[r}d˸>)K9ߨvy7zIT]y-\Mrk.rgJ;Zf{h.jvHmSHLEDL#re87؆˨XPz}O&(mǘf60帵A} sX}ŵ= !=!H~ڞjNoڲڻC4m`r;`}DvڪWiSdߑ~Sۑ\on_Cͮjjv#QP;z;]軣ZxlJY)8D}L秇ZhX曢::y>k>Ne'J3VN5 kkg?];kX?YcZ~4-Fp\5=9EX5&Vʩ*.5F''F~ƿy>+|\^jiq61.ʬɐecdʯkg]i;uxu"7kGP??TWgCc fDg3o$Z]jm%ʫА"kr㘮f#vD#Yp>F^QSGuq{5{p31";=81>"C3G(d?Ecѯ)߭S5NN^8ٵ!mC9_O"?7jGSO-u4U}գz.1q^;*o5ʫ'Zq㱨 "]zE+#ǘ6T(4mG8QږKSgdO7wnmxr25;yƚmM8ImD1F6W}zڶkXw~ȿ,.W~!GFNuY5:' 규|L>ӽkN'a.GJwV6q7.n*fr)?ch}ekHyxlTQߕKN˅MH #X4z>?S ;nM~$ku{rW=cdؑr#:/]uG|G NjL'gsl#M?Dl *7%skQ{]Uٮk~&8ָoLpN6Q~.*[=S<p_X9E;#Y֎|l+~Ɏ4ӯ/xjJ]H?&#;Z)W6{>Jmv^{>PWs62F&!biʶ- Θ'5l8F.cw)܋}rHnّ#=r%clf2<=ctPӡf\i;<"c.=%&3h;v1*KߌEl؛ftySYR$޿;\{2xhN8'߰' J;/뽅Ne6Te責}R>}vi\ͽ w./߲5 '䚿A3P{ hwQҶ |[q_Gc {}WYY=t=`Nm߈o)tvW6 ~mw] v>pJftlL\-:m:]6+SruAcn+ 坿g>]L{%yqo@ gStߕ6|R{lU`v(4g1\sɝASߣ1j s^mhƽ/6-pZ_i<˶L9\h-dhp,T:ՔmXNеtu헝{(&ͥP}Fe;suQ^kqӇҝهknMJOղ>C)2k7|4#:b2x=q#[kuS#u+xGm?j,GM۷yM:|GSO[Nw緜37۶&ټV>;oY黾pYgL{Ƶ=o+wy>X 5mEY&[#v|/-QlKiT)4u~l*Q&&RV|_\.#WOS }7'v"3 ͚ݰ~Kk}RQD}>FmɾdLrkGl#ؖt\-uw*ݹYN&lk}CAN?͡YT;ʍ5qp^îmoj?ACvuU{dm@m5~y]=;Jb|)k5tʾz̡Pf?¥XR|c8nopYO1#1/=#v)=?K(׋SDlΑc%yǬỵcT|]6 hwteos4xG7;{ڧ糲[9'?庨OGpcȟ0M͇B7>Ppgyg R7.P.J]KcGI^c3Ϻ8hfssCk[?sse<zʋDGΎXQNj4ow8;~<DAucU;ϔ_gKys++Jٲ[9h.aY)P~RtV4+e{e>OۼlE{?vĿmRڸYmPBm۾k_k퓟Q[=A/:oFc.gKueiX|p}~[?oh<bQ6 U~C5su8u]*jׅ-%ׇc6n]z6E^xܵ?֥gY<=eJe_pmUyͩ] 7e[ڶt|ӕiյՍ>oYa?ľB׋{YsCOv}UdjO;##,܇\\ڒC-[8|$?^0wB| =`lځt\>G;Z7"rr>UZ}zCD1=k[uy4,!Fʨkvr4Q#D@2ӐЅYG]Z1 2e4es:cH_+I[Λ)3I~_c,}ʟzk=nڨm"ueO89 8Bk•=|ܯ֡c^f̙v띲5vkʦ9#qGnL77wrrTT2U(ݘދP 4oɠRquCMAYEu >|0NyTY9Ɯ=.}(yd{xzΆl WO[W]t{G'xG}Ҕ~j?OJT.ǂD6GypڊkL [:W-X:GkjztUc]ݲWqA'-*XZ m[犘˝AQ4Ntrjܾe#So9wʥ6sׯ?T:l1s}pϑdڀQϣ5:GKG}Χgz|̆\E6YGj F/k.]3q;_jexťuu*ys)c^68EˌdkgZert|<8F62xWy=Gػg"fѸWmghi]G"2}&P7Gkyw4|?Z_uv15Yَ,_*vȫ׎qz'ph~ #:8Zutؽ7֜w ھkm~aV6g::][HZcm;w7e={nt?5^zXe^YnsS٫~lw*icg<,\qZեөd\Y/ΧR! \y^i@/?NҨ9]8ۭ?w^öQ#=x101eFvƷ5lڱ{TKi{:_Zkб aWh,>4WkU8]9\DVji_񭯕(tFCiz8f#5u7܎*ӱv:T,ju;ΚtI{o2.T]C锿RIIGuxY)se7ǎ~/;lwOo$Fg>avͿd[f"*wLz-";Z?':oj|oh(ۼpZ֡4'r |y\Y̎nN^]3>}gK^a'9ꕔe)?D{>3#?Qz. )t~o)ül;5&kg|UV|rgS{^>֣>wL ei:VCoz?{WdRŶyC|:B}JS0B+!Ɛ\lc3m:ghsX'bT7/;L4V~ԷG{yt,5Fya <&?NRڅnf\]-vݡW^uTStTuy!Ћ\cEc1?OJ{XA勶Xc !5>o_uנvtW'{O]>}6ܵ]}̕)˵9lp4>fh_6]u;g;(ޫ텭Arl29bFD<(2 茕o>^(.X[3V߼$چZۣr:M71KrXWBqmjOn܎X v >(Ϫl|qY}g</.9ڥ29psszŝȄRCq'ӀqtwPC>v^Y‰)/|C7?5B<>S+:1&G)MHFe5Clh mќҜEYį.^tut}S.yUP>9U/<߆_9_q]^s| >%8{R ._u2/c;tڦkem.tZ6&{%?i_*=/W}#>v gU6#u:+k!_j~uձH>94//Qh_f˶4bGZQz> Mzຣ-}-nn/<|Ϸl/x|xϴgtoi|ŇzwRZ<-n^OHw[;=菐{>׵׷j'7nأ?qR_:tՏ>H$_M7?_o7ͫՇ[}cgHn"H$DrCD"Ə\"mH$D"H$D"H$D"~ˉ;9I"H$?N\J$D"H$>H$D"zM;H$D{_:qo4~&o|D"H\M$D"H$D"H$.?H$D"xGD"H$ĕO=>D"x[]=H$ĕ_x4H$D"H$D"H$D"H$늯e2nIwWIɫʻTXWl{U\#Mr>kz>|dw\el8yTϏM_w&?UZ>m|6Y?wϛ]ߝ/cڟɅcҟw;[w~?N.<֟wԟw~?oϿy //3_|湧/}/~٧|{/]nK֛o?s)}=뾇zgx};z5)|[nѣWx]_o}[G_ѿW~wr L^<3yzKN\?8kT{-k\Ӧ|=|{cg۳'/Ok=9R{xt^j4urs6'ڔ4}M<roK={Mr[-Ͳoi1Kym޷r6]/.>ryg'_>|Gi+7=_~SF[^UW[PS~W3)H endstream endobj 57 0 obj 31757 endobj 58 0 obj 204144 endobj 20 0 obj << /Type /Font /Name /TT5 /Encoding /Identity-H /BaseFont /ODLZAF+FZLTSK_NWCM--GBK1-0 /Subtype /Type0 /DescendantFonts [ 59 0 R ] /ToUnicode 61 0 R >> endobj 59 0 obj << /Type /Font /Subtype /CIDFontType2 /BaseFont /#4F#44#4C#5A#41#46#2B#46#5A#4C#54#53#4B#5F#4E#57#43#4D#2D#2D#47#42#4B#31#2D#30 /CIDSystemInfo << /Ordering(Identity) /Registry(Adobe) /Supplement 4 >> /FontDescriptor 60 0 R /DW 1000 /W [12[641]14[641]17[586]18[531]19[531]20[527]21[543]22[535]23[535]24[520]25[531]26[535]34[762]48[703]260[1000]261[1000]263[1000]544[1000]545[1000]552[1000]553[1000]813[1000]816[1000]820[1000]822[1000]823[1000]824[1000]826[1000]827[1000]832[1000]839[1000]841[1000]849[1000]850[1000]855[1000]858[1000]865[1000]871[1000]872[1000]875[1000]888[1000]891[1000]893[1000]908[1000]909[1000]915[1000]947[1000]949[1000]950[1000]952[1000]953[1000]955[1000]958[1000]961[1000]967[1000]968[1000]980[1000]991[1000]999[1000]1006[1000]1015[1000]1016[1000]1019[1000]1027[1000]1028[1000]1040[1000]1042[1000]1049[1000]1059[1000]1064[1000]1066[1000]1070[1000]1085[1000]1092[1000]1093[1000]1094[1000]1095[1000]1101[1000]1139[1000]1146[1000]1148[1000]1152[1000]1154[1000]1158[1000]1161[1000]1196[1000]1224[1000]1226[1000]1260[1000]1264[1000]1290[1000]1294[1000]1307[1000]1338[1000]1356[1000]1385[1000]1415[1000]1417[1000]1426[1000]1532[1000]1650[1000]1653[1000]1682[1000]1685[1000]1689[1000]1694[1000]1696[1000]1697[1000]1698[1000]1699[1000]1700[1000]1714[1000]1722[1000]1727[1000]1736[1000]1757[1000]1759[1000]1760[1000]1762[1000]1779[1000]1788[1000]1805[1000]1806[1000]1831[1000]1832[1000]1837[1000]1840[1000]1843[1000]1844[1000]1855[1000]1860[1000]1861[1000]1862[1000]1864[1000]1878[1000]1880[1000]1885[1000]1891[1000]1895[1000]1896[1000]1914[1000]1948[1000]1992[1000]1997[1000]1998[1000]2005[1000]2006[1000]2007[1000]2028[1000]2047[1000]2091[1000]2098[1000]2115[1000]2118[1000]2151[1000]2152[1000]2158[1000]2160[1000]2164[1000]2165[1000]2167[1000]2172[1000]2178[1000]2180[1000]2189[1000]2200[1000]2205[1000]2208[1000]2209[1000]2223[1000]2227[1000]2232[1000]2252[1000]2280[1000]2287[1000]2295[1000]2297[1000]2298[1000]2302[1000]2307[1000]2308[1000]2309[1000]2320[1000]2327[1000]2329[1000]2332[1000]2333[1000]2341[1000]2342[1000]2353[1000]2357[1000]2361[1000]2362[1000]2363[1000]2366[1000]2408[1000]2437[1000]2453[1000]2489[1000]2554[1000]2733[1000]2737[1000]3080[1000]3085[1000]3087[1000]3105[1000]3114[1000]3123[1000]3148[1000]3157[1000]3165[1000]3168[1000]3175[1000]3207[1000]3217[1000]3256[1000]3340[1000]3366[1000]3367[1000]3426[1000]3457[1000]3531[1000]3608[1000]3613[1000]3633[1000]3636[1000]3642[1000]3644[1000]3651[1000]3655[1000]3657[1000]3668[1000]3670[1000]3678[1000]3681[1000]3716[1000]3754[1000]3759[1000]3832[1000]3841[1000]4031[1000]4221[1000]4229[1000]4240[1000]4243[1000]4246[1000]4270[1000]4276[1000]4277[1000]4278[1000]4281[1000]4293[1000]4295[1000]4298[1000]4299[1000]4303[1000]4304[1000]4312[1000]4323[1000]4326[1000]4339[1000]4364[1000]4390[1000]4392[1000]4393[1000]4403[1000]4412[1000]4414[1000]4446[1000]4461[1000]4463[1000]4482[1000]4510[1000]4634[1000]4637[1000]4648[1000]4875[1000]4878[1000]4882[1000]4885[1000]4895[1000]4911[1000]4947[1000]4954[1000]4955[1000]4965[1000]4978[1000]4994[1000]5023[1000]5024[1000]5025[1000]5027[1000]5036[1000]5052[1000]5057[1000]5058[1000]5065[1000]5075[1000]5076[1000]5092[1000]5093[1000]5159[1000]5165[1000]5180[1000]5186[1000]5197[1000]5214[1000]5222[1000]5223[1000]5248[1000]5250[1000]5263[1000]5278[1000]5288[1000]5297[1000]5316[1000]5360[1000]5380[1000]5382[1000]5400[1000]5410[1000]5443[1000]5450[1000]5453[1000]5458[1000]5460[1000]5480[1000]5501[1000]5519[1000]5532[1000]5536[1000]5558[1000]5584[1000]5618[1000]5664[1000]5692[1000]5708[1000]5877[1000]5949[1000]5950[1000]5957[1000]5975[1000]5988[1000]5997[1000]6008[1000]6011[1000]6016[1000]6021[1000]6032[1000]6036[1000]6041[1000]6059[1000]6060[1000]6061[1000]6071[1000]6080[1000]6084[1000]6085[1000]6095[1000]6097[1000]6098[1000]6121[1000]6134[1000]6162[1000]6169[1000]6188[1000]6190[1000]6196[1000]6198[1000]6206[1000]6226[1000]6269[1000]6287[1000]6299[1000]6317[1000]6326[1000]6335[1000]6351[1000]6354[1000]6356[1000]6357[1000]6359[1000]6397[1000]6414[1000]6513[1000]6516[1000]6590[1000]6701[1000]6748[1000]6758[1000]6763[1000]6764[1000]6770[1000]6773[1000]6809[1000]6813[1000]6817[1000]6836[1000]6852[1000]6854[1000]6874[1000]6876[1000]6877[1000]6886[1000]6890[1000]6898[1000]6925[1000]6930[1000]6931[1000]6934[1000]6947[1000]6959[1000]6971[1000]6976[1000]6994[1000]7004[1000]7047[1000]7068[1000]7079[1000]7125[1000]7199[1000]7201[1000]7213[1000]7221[1000]7222[1000]7226[1000]7240[1000]7244[1000]7257[1000]7260[1000]7271[1000]7279[1000]7283[1000]7294[1000]7310[1000]7314[1000]7340[1000]7342[1000]7345[1000]7357[1000]7369[1000]7383[1000]7395[1000]7442[1000]7456[1000]7476[1000]7484[1000]7486[1000]7524[1000]7525[1000]7529[1000]7535[1000]7541[1000]7570[1000]7636[1000]7642[1000]7661[1000]7672[1000]7738[1000]7815[1000]7855[1000]8014[1000]8023[1000]8270[1000]8271[1000]8335[1000]8336[1000]8337[1000]8338[1000]8339[1000]8375[1000]8418[1000]8444[1000]8449[1000]8510[1000]8513[1000]8520[1000]8545[1000]8559[1000]8584[1000]8588[1000]8589[1000]8654[1000]8672[1000]8684[1000]8776[1000]8808[1000]8814[1000]8824[1000]8868[1000]8885[1000]8886[1000]8990[1000]9021[1000]9038[1000]9046[1000]9149[1000]9175[1000]9204[1000]9230[1000]9276[1000]9281[1000]9371[1000]9624[1000]9628[1000]9643[1000]9702[1000]9754[1000]9827[1000]9876[1000]10073[1000]10150[1000]10265[1000]10327[1000]10331[1000]10420[1000]10460[1000]10461[1000]10490[1000]10522[1000]10547[1000]10771[1000]10828[1000]10837[1000]10846[1000]10850[1000]10856[1000]10886[1000]10898[1000]11176[1000]11178[1000]11179[1000]11185[1000]11255[1000]11262[1000]11269[1000]11291[1000]11297[1000]11301[1000]11310[1000]11320[1000]11340[1000]11373[1000]11538[1000]11552[1000]11585[1000]11617[1000]11629[1000]11675[1000]11706[1000]11879[1000]11883[1000]11915[1000]11932[1000]12008[1000]12030[1000]12060[1000]12088[1000]12128[1000]12164[1000]12204[1000]12206[1000]12280[1000]12294[1000]12299[1000]12353[1000]12360[1000]12371[1000]12377[1000]12406[1000]12419[1000]12454[1000]12484[1000]12494[1000]12532[1000]12712[1000]12753[1000]12779[1000]12828[1000]12840[1000]12877[1000]12879[1000]12884[1000]13263[1000]13268[1000]13277[1000]13282[1000]13284[1000]13285[1000]13292[1000]13296[1000]13297[1000]13299[1000]13300[1000]13301[1000]13306[1000]13308[1000]13312[1000]13314[1000]13318[1000]13324[1000]13332[1000]13338[1000]13345[1000]13353[1000]13363[1000]13379[1000]13415[1000]13438[1000]13467[1000]13471[1000]13495[1000]13521[1000]13614[1000]13616[1000]13618[1000]13625[1000]13669[1000]13689[1000]13697[1000]13703[1000]13788[1000]13817[1000]13833[1000]13866[1000]13878[1000]13995[1000]14103[1000]14112[1000]14113[1000]14169[1000]14236[1000]14237[1000]14239[1000]14255[1000]14340[1000]14355[1000]14384[1000]14500[1000]14674[1000]14698[1000]14926[1000]15025[1000]15348[1000]15407[1000]15546[1000]15737[1000]15758[1000]15765[1000]15832[1000]15858[1000]16044[1000]16046[1000]16110[1000]16111[1000]16113[1000]16115[1000]16127[1000]16144[1000]16531[1000]16590[1000]16593[1000]16598[1000]16602[1000]16603[1000]16605[1000]16607[1000]16613[1000]16615[1000]16619[1000]16620[1000]16622[1000]16627[1000]16642[1000]16658[1000]16659[1000]16673[1000]16680[1000]16683[1000]16688[1000]16693[1000]16719[1000]16782[1000]16825[1000]16972[1000]16974[1000]16975[1000]16976[1000]16981[1000]16988[1000]16994[1000]17009[1000]17016[1000]17032[1000]17058[1000]17059[1000]17060[1000]17074[1000]17079[1000]17120[1000]17144[1000]17150[1000]17162[1000]17164[1000]17173[1000]17180[1000]17186[1000]17368[1000]17555[1000]17561[1000]17563[1000]17576[1000]17578[1000]17584[1000]17600[1000]17603[1000]17608[1000]17622[1000]17638[1000]17643[1000]17652[1000]17659[1000]17661[1000]17662[1000]17669[1000]17670[1000]17672[1000]17673[1000]17675[1000]17706[1000]17710[1000]17725[1000]17729[1000]17735[1000]17740[1000]17741[1000]17780[1000]17792[1000]17918[1000]17941[1000]17962[1000]18042[1000]18064[1000]18084[1000]18164[1000]18167[1000]18169[1000]18170[1000]18171[1000]18172[1000]18337[1000]18869[1000]18892[1000]18898[1000]18926[1000]18990[1000]19116[1000]19221[1000]19226[1000]19233[1000]19276[1000]19295[1000]19296[1000]19299[1000]19314[1000]19322[1000]19325[1000]19343[1000]19345[1000]19350[1000]19364[1000]19388[1000]19389[1000]19401[1000]19492[1000]19501[1000]19583[1000]19587[1000]19595[1000]19597[1000]19599[1000]19606[1000]19878[1000]19879[1000]19889[1000]19891[1000]19902[1000]19963[1000]20163[1000]20377[1000]20392[1000]20409[1000]20437[1000]20485[1000]21505[1000]21568[1000]21629[1000]21894[1000]21901[1000]21902[1000]21905[1000]21916[1000]21919[1000]21920[1000]21924[1000]] >> endobj 61 0 obj << /Length 62 0 R /Filter/FlateDecode >> stream xUK%nF0t-F^y v2q{o_l`UQD"k/qy;߯?~\.o˿~OG_~5ǧx?/oD˟߾z??oN}o߶z~? p|~??^o ?8AA' F0LfaU Fp5tÇ~p0zg: +6  F `f VP\DNED9 B&!zW2jC᠇3:Q2Hhha4FY md& YuQJũZ/Æ3?0MO>oG zbI݌NY'Mdˊ$ 3۱5jkBy]VzB3U..uSݿEi9]{:> dd/D}%shEh׆VEZqetD͈IOnl5F.ncG<#j0YnfXG\%yݪw9 #gu?3lzn ;)OLxʄ#xa(.W+s舋:hG$sIE+9N4H4 E# Sfۣ)@GH1q9ouY(QvD0J"4Q3"蘄 Bj^*xe&3*wԡIuhԼ$/A.Qb"{CcȒ Y5԰#v mz`ަyDSZL 1pHp[nmV.*\%FScuI^9<' 6a5VIJ:®*[HzZIO.fڰb*rk5#J(+%V+Z% y vYxj55C:]5%<MTxW0yمdnYhEt2nԘP#{FWFovA'ᄫʳ*xl CV˳bH}$Q*9Gr$JrRHi4F&JcI)$ ѪJL8if@+eb {%r:0 =Ȧ %G)yۆ a=cº mSWFѱ3(`V<6c+> v,]U|2'λ ZjF=YZױ Ȧԛygm)kb?#fȹB_N }[%h,'E!=lY#'eͪI>5-ײFGt&n2^ ѪI"RzBzJFMtŻ%n$ō}].n'|r^},D3jԲsλ5Y9v;>;)]svdV7FFq,G:j@Ut4{2.YZ%*q5YE;~QYDUt4%[u/s{$`Z #Kwbݱ.̇Ў2&t} B+cO|7N2NQ9HU$U%TNFU8nֱ 8 mUըZ SdNN9/3NZQӑ .˪܅69!QVAh==ݤ'ivAr,$ө (`0䲱jދG=l<ҟ Tm!@.:Px{ eST/'=lf:j^kI剖w>5u\Dǵ#ү5f_&j=9jԚyiUyZA;>8D \.E>64XQr9G ȇX&Ԉ䲅\湊g]}dVB$cWy d'aKe lU[|mq4o}Uqܯ|hV<̗D(*Ew_KW:FLWWK^=Ӑi|C %ŔrHެT]!U߬1 +n $nuJ)7p K&:%hZezeGt>eE#zخ e_;$٪([.pQEݟ=0BU_cKǞiT>`i;WnrZʥRK״ta̿X4moˡY|#4+-˓Ҳ. k5V+weQFZ8$Q+'=FXFnM瑠QbNpxgeK([z3<+9~NQ?'x+L9=hpG V (`t4Q g?K^G=lFD`݀ ( `"Yn$OLZADslBޝcޥ"{twl  }+/:!JMYV.$RD:ڦtBy]|co$*Uu ɾKv B&a9ٽ9!FF^U:$Ku Mt._BYh_evk|# b߀P(#ut Z`eWˎ!%^darc%t4C%I^A [/<ܬ\W`ֹe7r|:Uun^2ʴpX|o.foVzJNT+ieᲠZAjp]Do( `0pYk|ܐnȑX`1 3؄8 wpvī7A PO!Fq$%W SGLt\^ËƁG8 BG{wtx݄uL &8u"G3L8CtyN|^.uHJݏ0XeW:sUޚ?uW`n[;fa p;BQ:L4i{`8 DQ#F=jНSpbĽWwSI/z DEkŢxL4с&QU'^BԐGBJcxd+q*d"2lGuGVБDXI֔b T|1E \:)> endobj 63 0 obj << /Filter /FlateDecode /Length 64 0 R /Length1 65 0 R >> stream xw$gy'z+<=3ݓvټڕAY H12&A$6}9` qgV`c8}عy:};;UPBC^N89r-O$. W#9xh g]>nWBwmͷxݙ#`[`˿#yߋ(~5'NƏ;{='*F&_;o߃_t/o&?M{=coM(y9}3Qr⧏/'Y1#>bݧ ~] 'g& Y195=3;7Y^a[l۾c{d9z]~ʼnN_y\K/ gÍ=On%yw⳻?K^xEy/|v>-y mI俒o&?&?#?'QJ3D'N//'77O:97?WrX9ZkQPԚbm]mccu^WF=A#(6jhc146764.m\׸qww5~Ñ[G~ct G4>1ǣ/~5Jssso{O͏///|`MY|_,~qů?[߽㻿ݿw٩gz~y?|LTz|k*}I@%_R)SʵQT~O_RERTZQƙ]TvQ2zdo}_8R̩sܶߘ{sBMR鍋R+_?DJ} P*eJC?yܹs?w-to>7n/_}C/Z}pׯ^=::=ss>r}4?'s>~>~~柞3{[|73=c=c>#}'ξ;Ύ>8;ttp6>͜͝uO>?{Oo?OӟxמϞ^kzS?uS:>rOeSO=Y}d$ʳ_W~|___~ٗ~K~̗N䗮7߹g<'O9>ӓ'N]Ѹ~E+r\L.듔LډD~vOO磗=rD񕓵' '裵=֞k-赏+὏^w3M 1$o<ϐkT֝k2&LcڣGyvugWF#q'gkc'n9zOo=gY'frcp 8IJ5飏+[럡$׋]@W|ke^ :ɝplkjL'q( KFt:q+nuZw&&ÛOO,?k#=M4[N5GƍmhiN1v4gWW2A+Y@΢ ?vJ;qG{P+LC;NL3nRJ8!CpdgՄGlɳ# -/6ꔍ48O&e TY7o4aΒ|eP5E',ctfh i1~%m ypL2NEQ%{MbEu-Xw F*222D#tlB@[ctn$]B*cH,%┐14Ul&PIml' S BDHwp=>\KɧH!x!Ehi%`/Bu1ʖۜ5MJ2UXVRJxOWՆi/vPa2RȤFM:90r鍜DGC⼾"tV*MXh\ ۚ&y# B=`Vf}P9bTV+ōf߅3GC=~-h]Nkv9kP6=C׍29!X}ѩ4eá[^sjMal໒Vߘ 9o.DY{)QӘi4U6p%a;^, ovj!z"l&pMdX썪ˣ )ܚ&-GS9:yC% ?|޽gnXV卧N()E9u\Վ] ˀC_x/ Aތ@Ki}==xH=,T-|Gϑב@DzOd)AZΘ9YE 1u5)L!Hn׋ܘJQoxzn?Sz&}YnueNMfy:UEU@ ׇ@)(Y\cu dJs\VJX8-(nW>YuWOI=y38ۺqy3_YL{Ef= J%$x=ĀbxDmLU^GxtWxۢB ]CPWȋ@WOKd1jZhEjj{ުQ4!܅Hꫠ@E8$%e(9K,)Er{-&Z!R1c*rRoUB;w0OT$rڤjoڔs`Z)681RFWUo9NЛ2ڸO7տElYB jKt1cc&rW 7׉?}J~rNo0 \ )eҚSsa'gˠ}?j3~0#9$6QZS5+ \>T_&LƇ[6È|;|5':hPV4^A#U=qv#`ǟfX3PCo̢X>Z6k`4xf.Q\X -g?뀢g,l Zs{+BZe+q؏+^#1xݦH^Ư!jtD@bł£Ǽ,`Ps xj0咠 pϿϓa2T2a/x@hn-wOQk*Ix.IFCP\ + E-'~lmzaC**K/'܁S-ϱ %-ir=Z\RDkO7@3x "uDK|Y6U2pu Us8)0&4ܡ=\*)UvCK5Ie\! 6wBC//['=u:>:3Oːk$ y=hXZKBAF4DtPQTyj8a.#wSJ< Z&?o1jY;l?~f -\^ xt1)a u| >HM]`SThVuu)Mxetz}J\C[?#_#q;\n#U'KǒpSW v#ҠI,HUmb872)B,Uӡm,@㔫jQdwkj1}gAgT5BHFqyeQC^@&Ӫ;j"k0jjXbBJ1׀lOjwZj܀8nKm prHm&r?y%qW,rnZ p_jD:q"ږ/ G5oY0{pc3d<7$G6u8Si׊ש_dyAr=s ɚًM Mp{&r.f\(pݱɤK/ FuJ&@t@ 4CW#K8Z Q4 MZ:G*dH껞iڎ|<٣$[:@^)J!Y%H֓2d5h//\XvG ^1D:Hz%D9kfpVcGXڟ>QD'Kd|զ=2 Bo;FHEňX % 0p@?rPI2 8$ /)6tq}-E'&!4.Wǩ+cF.\g|M¢,3jS'O AStc 1=-TxmSvq ܛM Gv <]d?9L+qu=]py޵\'""VJ\.@$?Gh >2+CGAN>z$Tj,h,:,WRZFkDBHіS=V^)&Q/$',YG6aߏq}u1h~xN'ZP#U`,NtaKZ=-K͖vy.~;/&TZu*t;c1 3*ި\\ {H}G0dsqrKk/Y7pƈ\DO>lF3.4cVTI<"n lS~01 `/hZ;9<Ľ^ ^bC&Q)Q3KX M/ܫJ!K%H7mZBCJ 0)Kꭊ*"Zk|V8܉-.UVV1 = -itD+*;f6[ I-e{ 5M8DD-LU$4R!`nr)xt, F^ՅŻYXܰ ӺIKd\e},=(3scY##yѺ{yط vv. Uf;D2`X#9I0 B3Kz?DtӍUpԜmhxOݲd(ZÅIGe 1mUlMH vFIt0xD脊}#aqRC23;x.bͿu |!g7[  b>Y&ASg%#Ā;ׄ4?g T h!~S) >QRAOTKY? z$uA 3, +QJeSy5W[Մi!yZK~|2ġ0;f8L"?*]K eҚhB^OUAu):CG;0I5x 5SSO/3POi>2B`! 1>YvuU1OM$]-nY\|@Xx#)PÁ zV^_GU\aU~P3 gLQl3C ޟa\1[}-D~v[Rii:coX1r%{{ XE j"%b7Ԉٓ$y2pxYːr E>CW.WZ[ "j}`(Z#dB.ҽeU` a͗8mAΩ=d.] _"Ft ҟTBˡ: W.]ϬF^8+FH?^̔UX D%v1pb!&J&A{T4` Ҁn?ԍ s: # p% =-ͧDZb,GAk*4 `9dfY\=<(aTrIj1R,pJςNWg~|B !"C3~K櫷F$f$lP*ᯁX`ƺJv14P0 k_+~gį[cD%iwxʭ:*,],5$5$fkz4Q8  $ % #2@E+"BF>Wp곡tw;RSh#ڽ`G758a$+K#s al 9b(? d%?r3AU_ 8[U2jUE1;=l J)-g*L/l 34>#îZQ2Ӱ<^u{q9qK7i4eM zӧz*>ԧz hhTK%o%1+f&Bb'm&t!Ezy607KKC= EJ{ɴY{(V>L&L*woe-QmoClBÃ}= 210*W O%Q0f,uOyϐ$ ʣ3J ; jY˦!x2 Tak XɧH{e|'7W~ˍ'x[[>XM#+{xG^w}7 C9H'v/@ ;5Ⱦo;7+ˇZkY$91< "u5f23BkItu YfpA*r1@l h1WT o9&V4Ij)0b*E-tXCr,&ELp 9&*l9>&U@4u<!Ju@Qf`C{bAO m*(\0V'!xh' _$b /e ybŭLHjjfHy+)JˈSF0=h3hR' V4$b'1 g?8^VG VWJ@J#L V1} [x /:?=Yv3ǡ+' V_YC!֊=5qq.R557(E$;n#:WW܆SJ,}$+24'uUwҭ n\ZӿkXn&ڿ P{^h6(~uDPWa mlPM(=E{ \ cʇ#6 f;ǰyBhm Ŋ娲fN pRs=>:9a(\N놂4M>b9J^do(-e血p@-MG!IKĥWl`BdlAҬuYWpSv_J5Oê$CuM ,Ex D`w94e?{Tn +T 7L5P!,&-w0"2(+0Nu}Cg&~t!hk)Cjc`% U`765ˬ `* }* eNL7, M1$lBIՃ70׈fy6}R"?aL::x] ՜:AA$f6Pk@er)PhNYmNf5Ri$G w^F\[3LcVό/Й%Ѿa+ȉsI%IܜYKڈb+3Ʋ嗐.^[ޢV |hW`|KE4^U`桘mPo O j@0Uý Y%F&I ݜolol}'\]C rqx]=Ҭ5OTϵ?Lԝf{MW*S490Twu`:ܶ/d5nohz56ֆϙlA$ЫJ{XLѥZ$º-VT#"tHȨRZ$-kD9~su&\E(:Y$Y'$ %8J/Yu:N0TpI@DJ=KW1b.gI*q $gabEx\:p$XE{iuziۄhiySdȒ%^#ֵЌn蕺"=^0-ZH.rqѫi{hEAV=VRD]i$0̑M:Dk'YߣdLJ(sULC^fn W1%?c]A+!HZdJ-}u8nc* W T[FЈ -I/h238'1kH/)GY︕\OTdF];m!MJF&@#9Q?4V3a|55os$ &7+YH1gPՃ˶TQG$Q2@ce n-"*/7TTwi p ;~mdžiJ+kX:G@ cKM/ձXn U.LMA88$->KQ 6qN (jPPV'Av !|+0S7wKUdM]v&m<I1 / 5IR~)n9<%2B(B\eWnHfv زV  g2ضgӰ/kh`$Xl)MόrRN/ ^cZ@< KRAFNӴ+<=x(kda#spJFkcx%/ibMI2ԭ8%^/5|px2-,NVcC[eҋ~&W#BQt7^6ʫ=ڀGY9hZ1|kK5%q./*FĞ0ص'gTc[Ciq3aJd}newr0L\a(dZ8 LM2y.GN/7`ѝZ.K P&k˲ibHD"E[dH,kQ^dIn %s9ӷR u)5`_-ucvf wE3_VԭlXkQS(W4 s)=F6 STizY+]R^Fѓ)HPe^ հC]g|u\oWL |jPz'\7Z !Q\<ɍ_U::\}biў~'b-Yq*v";$KdtyixӓRkwy0bPe N\,(EFw=sQ Y#rdw6Q賤%]ME ۙ9[fr"6H8怜K˙ݒB7O8 .}^߹e$b9&so*/$zS:4z pCUI39>S_m$hXlPOsˊsV(5moP0`0Ox5_'@ĖfՆtZe̜%!d1צ| '-3eVuc )63Z6k),Lb;} rru0uWڊ5^h ,m_Kh?)%@ŔG]LE2e!A5|~)cm6U<ܧ3+d - J9/[VVe;[Jz ȑ9s;F}r71MpAm< FhMml &!;3(f' 9mOgOf]nUӂ~Pkp-'xlfBPϚF%VFUd&$,!tklj[MN%d3Ro%#-=젆6.of09Ӭ)O+#1&/R}Ff=+Wd ʼ-ά|Kf'1|F)*L ={o S'-I~jaX85TڀKjMGPhI&X*g名CU @?#17Ij, ' +ڍp{fk<)LKʖqVځvF'Fe)[]ov=7f7i饨ihX$f,p] ~QFZDUX-Z/qqw0VG ߏ=OAmB Ug?=$Z`x> 3MxOő[qI.vzN7U6m'^xE;N: U!Ear-WYim8ڝ.b揲ϛf*.WxQ`|¦MD3aW\Aыb$I7$Z:\jZ`9?;# &(aH+]R1v Y7.`$(AK}52T5DZ %L5xk^>Ml4B2_cS `F([_kF||c7,5Э[;8Z|ۮ#?\ueo~54h.z[3IgtH.2c;*ʬ36DOZPiK$*V`0\KaWmKj4AhOm|>7,8ݒ)|D^G~k 6T6&|4cQY@YGXub@јYD~!wq[-2ӭt0ݟ 4;hGd-zC`qC})oK[ȸL?p$dsc N K3ɋغ\T["c2ėvZQZ>o2 K3uh:z*!$I]@/ H1&qsQ$c!OeT6ai*! W5g^ 2G[~YNk g'N_x0Fh1Vk1<]y{ =޻F: SB+ yyN,+?n$DJ_jQg'$b%}SέH{B`G8޾QX*g6jهd82(~fK44ѵf$':wm0 p3pW>Unc〮%|Lt/z XϮ:/5t:o(>ϰJ?aAp> ,,Qxt5uSKF XgAbc3 لkf㛓h?U( '59TT>3Z ߀RwCP_bI뜎}m89m4`簔KXr .8d0Y#k-wS˙,"O\@ArZ 2FlUcUVx$r4hK!9yN!WD-`0,T"j$TshAUb&dYK4)ԛD2'-]LG0{jRQM,)& Ė KMK+U%}ޚRg5ٗiR*⦸Pz!+ kȪ287,VY1xtv@"pY( 9 ]<4<,0*&m$c0֘(݆}s6<,*\TƆ,G-1$wy}O' Ovec떻%yxy8S2i AuС(vtDW]P50rM!z&oۨmw32썈ů#gê%/)[ *XjF莻7Re*I_Br.`yrAK[#`o{\㋤ 1L+Q;^:)X)4c -sd68L`kIYaok!M` lE* Mxgkpl5f.#,uX]g'[}/GdfeC?8~8/7U^ϧGnSS{,fv6zUgcylv˽28.$|Q"{W֑ļ>kJ/NReϛ$y -C2O =# ~p%& *?R2Ix!˾< 1)ȸ=ޔ< /ʵ5XCcS/-YpA 6Xz[&p72: u&VƩbVd$?^jhR-[@Oy>VR;Hh$JD-@ۑy#YNSxbѸ$ij1βRkJXW4@hDǔQ}4z+M'7Rr魙Rي #kZM|||>ox_c~?yX_Wi{9Pa6f{)Πs*(û~r Z%mWm%qOhȜyB9< M'wyvdg0PTx:ɹVmPǠIR#PY(sneEq(K1cZ$a12NB[0_0nlYZUTkRUדlebӎ8Ǵ?'Pyx@gt2!x)wÆpSxL \WM5Yنw_T09",`nIJߑ^uXHKtߥش l:); 4(x7̈́ӪVfkOXW~[c"~iݗõәt(*S쏴<͎U+Γ 0X Ք[')x%x#$ 9!

`{_•hߒt(W쎩lzƃPVsIeW*SQ(!la-X|mR";؉G Dz12 G[i8 .'ςO!&nXr[79^EIeul1R%n lszp\}d4:Yv!;.cn~K~ S@]KHY`wHwn;ؘb{H:wp/t[}먮)NJ(MUdHV_Ym$xB 2iωeQ, .8I)' k7EY6_Ru?4XcƲr go\*Tm9QP-Qmdm39jX_\7N=]m);I;/6p3֚vnqGW؏?'#㟎V䵈 V0Ydj%Bom1`7eʙ>9‡=@!Jz{0}lAB`4׵W[#oŸ4cYʌ2SDxr,?$8ɮ0ΌV_ [A}=!^[-9p?#(sT~NqʡW[ 6' [Vl=7ktGȝBrҖgm7`8:J&PJ$![ 8';ZI+o,PAp܈)( m~W?d̑r}<}4nc ] 'C=W7:G|eJ>dRBiUXase ͌W Xc;0KH%i943f77[y4j':;a63l2aֱ(jLrǿot2$X!i*hkԁd}0q1O?waђzJs"p4`\5`#I꟪+ { rKY,Nyv=4ni*=t9_#X-]޻lR ya]I'lo?ڛIseowԎ=Sv. Kv^h6 TEE][?hh4ecm\\ӾP&`v࿝s׽*&UIK%Y%K,y_$/x1NB-N&ɄtN:L3@B,$ӝ|s%2HTUn/~F`b6 Y'1ٟȔ!]>;澪dȺ=ˉ2rPE̦0ʯn|q07f/P/[eLD*Z:R*Is_cSK ;orFo zE7͍݂ͥ勛W{sᲳg;?74ڗSK(٩]fYrߺ*B_;s|~v!mu̘JNj/8 58Qa)4=,u0jb Cؠ I,+UGD ]9M oѫŹ+e2A`ȰJW&ehffiLg{# Mgt `J&]z)+oX怢r_lSe #4r1իNӂzh Œ:wԇ IF!o~3 w-cw:^:N3?X` .vm^Z]q.3 |?<,dH]M,P,Jcq6RB^`p@@܀/ ndk IckN! ]H$V}moH"w`* ?c#f(0ȁQ`(`ɪp㐑k?1#@Yf;G|r E^4v!}t7Iffwٻ+!IbGu4ɄL(jkX3,M]qg3*WG>*%^Jt 4#K XjBJNn!IȊ*r&?iyr'iSi9PJTJ;!q^^^fs,*CD . zv7-uf|(MAi5C i`e^v r9ViO<]jdvxWzJORUPiWbHưZzNhxh/ퟆP58XRZ:>׺ԂЧ,?Xfvkf))n[U풅QMjNl{BAkC*B9Hs([e&kYeNbxB`dw*#ɤܴ% Ie *f K4|x9@24 ĖVbBvRQCa$ 8 HG,ð:EH*3w+{347s s|oZ !4Q 6h zfr<3@M0tGh'MŭnrP+ PRl*!ȪaeXlz0 y/9q Gڸ6A=FC>Rԟ+B8Zp,f yqgx㍬OR;" XD;!x弒! &/&ߊ" DH ʐʹcrlC$rH[F6UaDlxiJTZ-pIMڑ5(3N7) 0Q! sWd2nuPX9)LUa Eo9_NTp>~Ys L21.7_HOYniDiҕJR"81vܛNwє2z?_ Ѿ"(x음t"C_;!R{YR5f4#!ˇ7&ȮXA9 ˗&Aca |ꍶd$rWE,mӪը$ee>q{phU'*JͲɮ#u=}1=?a=eN@1QY_ȷMX3q8>{(b~#!>"WTPyR8EUYُy Am6ܹуoK%O̒ iKEĴm^#Lf XK%qR7F{e`ZBWS9q_ 8/\׾sNصVΝߴq4Xa\e!`?.ihw@ ? yW8FzP{O{ٶN l$Ѷ#˂ n`3}}!!|b:&@P颃!O?-Hucc=d$G4q@ڄfW2 wm.ƕvV"QYݔ8{uMK o+`TϥKb,J@ωŧ:A~'gI{tӷ""BGK!UK o5v_-c/k٫7n`\, f࿫CYZaM9Aso;R:hK 3 y|WXY_!l3ypquPN5/ɕa|V-\VnF)!JFb6C^+߸]&yFmMP3)5Wӧm Q$`)Wp,mn5]YA\A@.ՖWP*3]a:Dю1;rKݪ5i:l܍ړ38F,˦.}C=]/{Aw=RđfkE6ڰSeP46G Ɛ枓',)F5pɈKg4.{]5, wY1W i2w`82F-!I>=7y봜;fx\9)bG&= 1X^ך!)bq`yԵCRY ]=p&{Җx}'_:3(q.KG`w'i3>x.a91L2WmH_;"_νk߷Ck)nSMLVUsEL+i;4 ۢ6a|Pd1G J4u|Ǩ:`ܣ<эQ!W o e"Gc+ʼN &#YkR!4u'ʙBn: M8f|i=ISeB׵R%[sX f#P_ۢ hԿRbpسx~]]swcB%zeæSmT}u}9xg?1Y4ݰqH&v>q$xbEcȈ[ N`-.$R&(qt\sqA+_VPpƷuPYsc , ,P!|.{clL 4ӜbGb2fmUT!kxTٕ3ͮ`II3;xFJn#ir5еV/5 SmTPpT׻Dyb@qkEmnLDP't6Flw6ag< I O3ҞJ)AW7wu˷; (d/mȄan +%Rn9i̍#Pt-H˩!Tslb³"oEv}ԳoO:HO|}#=F4P6-u!N0>r+]!,"}t&Gg]9ѡ];TBEԚY5q-Zq&[~a9V, w h3}l`d#]O!!FS4,J^IK7|Umؔ"00 =v͞47"#ZroG (srj=/dAƎ =;o{f+&90쒏Ե.NR5I3ͦK1CHA SvUol3Eח-hYMs\\w.MCf";~b]O41qg'"3 骗N%I,*Ƞf060 (w/ћK81(kBsrÃK. Q?&S ߃(q_h;\R5s(z]͗H׆ءS3MWR9ՉpYmp v(qRQbtk~ IcxZ5_Md]k2TdT 1Ū]6C^F]vVtMDtVA@-.-QϘ ")S>Dksv q2g?r t0۴ G N ti<-j'>:!xHCfMb2`nE6,B$pe"5B9"W 1k筛vq~b$B0Dd|mqU"/ߓKxLKWOqpBQ,U"oic:YpW&(SK5w)1wssh\@}1ji|MIFN)2sCX{x6.\% h)'q-3X6p I(}+IR,f17OL餩D4ib\%BV#2f <7C20 _L)EԳmLY`٠#c6TACIQM<&} O 5uNj%@kEݥ'ՇԎ^kSŐ`|{%&Wf!~_K: +8I󥵥 9쐐W:brv'bK4fxo?6Gj/*֪ΐ#MXQF  pH9r*°DqBGQR2atdPX |7hb0ZVgPNYnWtm怎^z2 Xc2giY("+-I'7qC-NN]Nr/ia܀(W@q:UzQ,a븮pliLKNEv|cBITU{>lLMbA]g<} N2]\-9yQ$;lY?C6<ó7ĐAx>5NlQ,i6:$獵lZΪugr-U1R\;}'`vUy"fbh9ẝ<= OU[TʸP,/˶`y_kvҫaC:oV7[ h ?,ƆO7Әxu}}I*G_f@Q@~ZITFJGMEL9BpbclDa$͡x;m1kMĈ_ȱH^$|$Վ"+ !NWײ'/_amڷ/lܺok\ ׿ d,n`&L8j0LlZ[բJס+k}gn3F(N\6 TRih5x{ި6]`1YT|n=Cau*7ub/G14q f*}e[pj:DV&[S/L]Taׯne+cy ½SYh2IY::ֲDc3&Y"QCU3:;o/SuNc]~{ k1v=A o@"?Nڃ0y;]]) Լi#0͒)h=G̝ڴr(vto2ti4tO!|[4rF"®މzeNB艱z,?vlݞB10\\lDB6ETG/B7\1ܧە]4XZČcI&8b1KٌwJ(3"SXvՍ\aI bbImK']k2\ Nf񼝐Y \FI4G xA1 SDi5c^ 7l.[`HlF٠ '%e1A-2ꆨw,DhH\$V|:*͏"LJ"&%2P W%'}-M=ˤ̜v:; Pվ*/UTk9~ qxG^,80z'~u?~2оFzݽ=*u92L`63jX&Q15AeVvXU)p1ͼk. pGL{X0v@S{NmV lg b "~s%t@g9Xesٔ]6SܴFU' tɌ+H,u?i ۲(1)VL (">Sb\XA b57aк@ڑu]92+ETdٲ8q+CKא -#>ħZaJ< FõQTXrTXxve-a 7Z&դ*z u*`WE*w( bJ۔}}-Go]'Jrwz򾿾O{;ѿtox9Fɹ8p./ pΚ^.P+č^M_ү !<'bpU>ḵ뤌D^rQ<-bipGo8ڌi̖a3O-Nu]hOFy׍xె<[ $&y:'0W/Sl8= ^Lq#=UŁBD* m:d/܀%3>mH^eS{$W+jÀ`+*:kv_3!Kt{o7wt#yQkQ >D҃,X:>K\U`}Fڱ~Tg q%.٧sÓӶah@JJﻹV(E8+hzbB;8u'U[e k֡МORq` pN}6ZRO@FpshY5qv^8ϸLL[LtAL+3S: :='(TóYKWc Liߜo+UYPaR`N!:__ ,7$jU4[E)81\!'SwnOi_7v8),_k"KI@kyg<3˭?zDJ/x$;u[uD cv-^i|Roc3ؔGVSvΤӺGmQЖ1t 's+vVű=,R2 i҈{ghtվk#3 ]4/q7" { @ء}+8'!Q$n++C?Ӝ 54M-W̌j(Q|lZ\"RsŭL^+DZ ORhK;k/~<aa,ww|^z_3YpS /6+ٖjCtJ.ugc!_:p@Y]w|T{G#l.<"`Yj~p}ti?,VoR8#r#}\ūѷhŹpa'B`i_ٻ%/.d#QUobJ)f~ԋ԰zB+cpRډfKN7Xe)ӱ/ nj58k F:E` ,W(" 1SA4'SQaW W_yݧT64[_724K-z]0N Ffb7 40oDŽ58b󮐾e<cƧ=HѼ-?͗Twbו8^QLA `}'`l`~:L9vt}Dlzn}:4X mlQ3NY;)dLĺ5r\Q_$Lt4-kԒ)nȬɻX]lQ,% C.jg7ý=^ܩӵW-1Әq:Sw֯ *XwP_\B CFh7±J ?d&pt n)<pDnַO vx 9A݊8-.cW܊aWߗ[/烿l*.{hmT 0 $(l(WH:(kO)/x.PJˤ3!AʻG XfWoA;ͦl 9k81ȍJߝg 5Ļ-xm0nTo{٫TȺ re|4>\ pwH5&yE>8BTͮqHSV8>$xDrm}QL@D>**TN~AR3҂\1b#. ܱ/%Z҂V-N 3%C^Se;wWf=n#閛*t;Me ^itSy~I<%+yBf,f +A&7, <$apW1ʨ-Z=rG#ܸHtq߽f3xT3'9Ҕr@g4M`8+D%ScbC姩 i >MN0xa5Q`\%(]73Tʰ8ǙMD<&ǝԼ+n-Y `"Ӎ}"CfNE^<5RRyw7fgxJRD!a1Hf5؍c׳7>컟oƷ0nMo5Mi:lxE۞JYzB]8J4+nrٰ/?/HTr0y6l 3(D^+Qn 3<\:r ,3Q o!` V(VqJLB: `&Bdzsa,]t^l ;".gTfkaAfeaU70jpÿ>[aحXؘkqt\s,|mp/{$,vӭp| -~};z+p 'm҈2"NH~Ue򪞘5G㸊xj G#FFJ)cҩV3"߻hfKpi1$n܆+ȢӒ+kJjxy1u~aOױ6??N;'uEb.6rFTM8,PR)ҦaXD=xqKqYf63*C!t<&IXҶ<b}Q&by1y/5 `pُb4R|qB뛴4eK]up=YAC; XXt=iڵFSh!ח +?>*WK*v}jn!)楴ᨱ[?dUX@wɝkct,p B8J䦕Ip#s4՗+qhG!8ҒA;RG')nj8UΦiAฐKύU,ڮLo؈aʓ$p?5KqshPi&wb.f;;K㹶m[4.PS`ff& [1c)❩+Si]K;MʕS~60pRjToxhih Jom˲tq~+ ad42Ѵ1ʃbT'"m!.G[ K9rhԩb |ۨu^]':ljƦ'Il23 3TșZK28,a)z tBٴN8W4ݻjwJfc &|?5v ;0]3㓫>r=;ו250g:1d]*i] E)K͂@=΁8#pUSŚosyJHenvPoW)7޶ˮW>U ޲sojDZs-8 D#!m!88 9O*shI \#vCy[Uo`MfFfto'6EpVs"[ؐ n&}7-:{Qj(5%yxh!kkUgsPs2kO~HjK3Hj"]]7*Xu-G7\q i,8 V8;]H)ɸY8펎Uw?6=_vz WvȌJ@kKm0SXƒ,[̈́笜hU*j0Tg.eie4=-NNj4SC˽sv>{ b!tk՗U-!G{ƣ4f:ży\3dV`&7dm :~{n}܄;qM i:H>+؞kN&3GUlVbBcօ)GҩU7{}SeVv-2~ 5eh{r9Rzdu*qHIEHl%clo/9Ll,dia.C]r^Y5i6&M#?ۯ%a13Dvi)ŚzB4Άpi=RiM3LPvM;-=1ݬy51u@rUʧ6M!Y~j9xb%ᛏɊ(O@mx<.-07>yP0: #ZUºOYuDA=? K/ ab ұknfߑ}|t}?+UYn2`Y$ V0`*#g [,i8. yTz?>MzQ=!jg Se@5M,7JL;؎)=x 1oSVa=a5Y/oVלfkqeRǏ8/݈Ztp7,cN'pVBf'ԯ/jO\]` k$>[ǎ|I E6o\$%C'gIЕPW&K=c+LꙝR`A%$0:E*F^%+ޟ yjlia>F\@#|}喇Fqu^38K< ~Z<Ӧσ+ZtsF (j^=Lb$2e\z`giԋNv 1x6%(%!I$-`Qm :^N|Yn~)xMY1~yiyQ~.щB`ȅ,! itlaoOe,gCl0n47{2Obpq~6cuRƋ߆-ײ[x~w,qحYF?q=ռ\Mb꠯m?Q~ [n{Z[,vlfG"dMةtV[9c]r>"1;=K#y%lvyT6UYeelHvhiJ9Xnoq@HoQ}_aw+^~{ju=aPꭿ#uQQDT? LȿM5[XQÏՓvGjn ZC5FUo*iX:g JŰ[ N{^{3IgH+",  BXm|) ߾`YP~YiJ $s+|upd]Ii7º,M<vBLZӳEpyT`R[n&>G3gK5ymY,J~TlV.`ٓ\c#ϟumgpX/A mo/Mf."Gm ~Khyں9-DonWGg/J)RY[zV!ɄF>G[o/it$EQ`nYjvچg¹v AoU(,[Nr&pWܧF/Ut"Xn8ܵ-{6:r8-m3GܘDEOTJ=?5<>qHҝshi$,u2! -އcp>b2*mOk[bLcXr`QFTrz)Br #3Z;&b`OlX-MM3v{%"[Wѫn;#+9b0Y|e9D͠7,]M4w A,b{/M#p()[r6p|hL" pU $4*G+`w$Q֐0lV,d5uƑ9y߃}>26rٕ;yrw?9F5%j?C?9 GsWlXMxИ]Ҕbyg!oڶ{؍U-l qY(Igh ѩ+EfSrbS|wImЃEp8G(pϛ䷟L,bV2&d88}%{Oؗן|ƻK-w ;!0lb߿ؙs%*D!%k9\[Y8$XBk%s\iBK%ʆDy8,T3 ؝%C<˦Ɨâ Y ]o"ȷ(6SsCJp/ G,){[nƂ;OYzi"-\C&1~_bA^;ƨ{.lϟ9o [Or]M;E/y?r*Кe?SMf 7p=݊ N hObqG2fuc'.Ww*ӻR5qLC|apq]-ce4ZA1OA7^[6]1?M vf(VhgRgM*ʌ1(CJԿd?`H 9m>5/G {C4Eo4B LdW0{.R]djgc  ,Ɖ& H(ʅ,tKqYT⢞9|[d$⤆M$֪\pMkC3ۃr{3Cv$f\mKa!+V>FdUc Y#K}<"O|] {}{>֟ ?=^%⢬Sn= hn{f'Kj*2~A8jl:=*gMe91K4i)z厴J~-5W29I ~yT^aw;:5ibݶ!2OMM=v>N!:p!-ID,+ `ܐAz|Gj'uBE*H> Mlt?-eM$|0Qcs&f8sRfy u9W`z+_/owlD)=WýTm},ު))OJ%|'5h O >dN߰żZR [bJ! ߷j*Au *ֱ%jIrFD<Snhآ&٘6&H2PZːZ 65]ˑ"}wuC—4S̀ Tq,qU]h Db\'N4J S%\qJUUj*ֵN2b - 4.)*zVW:ŶKildrpŲ >=>>>=ОKWgM;{ ?MLru_t 0\. /ӑLFy`?lUl~<&[er"A4Z;NyBR#%}$W\l,RӦy p\a軸x dQჅG lZ3ϧi~kX N>y6% `߲ aBB)ၚgv1$RR"v h!l"_NǢtN8*89aTN@$_CÆ.qR3 CPw m1)v;<˫SS6-ZVgRi5V5U-xG fW mJ0( W2Gbfתvf`ʆlJmeHS @_}$g# ol^m~aB߅t⾘oEgznKs/L=)EV~"RCnoT(-_'Sm%S2G--KX71Gri-u9b,+#wp k:ddx8&%gٗZZeb&F8R%a|$NJKN Eq9\m!ͯl3{qsɗ_^}nCUp|)6Z }zG<:<*| w]nHɽ$X,eZt"±ob T&O{ !1vcL؁3Sf*qL͚2x^֥J$^{ DMIZܦ߃| F<<7?k_}8pazeS/\<"ӳ|n`s.roK>l`gg4yG#d?n {0T@ib;ۤ;JTCRȝ -|밸ߞ(n (U׌܂OY iHi S 7;p`5VS`l8 VˊD1Uƶ;I5(LNs $~ =YvGov5.?we;ϯn_ыTG$ͳw%T`km.d@e6{-65ϋ%25ޒ޾-]f dȐǖv ng*$-9cpw:V uM#EBs7Y[w#|y wMoZJN{>GvI>R\Я;ҋU5kjGc 2\9>ﴶvH3%W>>3tGeAneQOJyVІ*G<^ɦDP\}9ێN$QA!PanxI s$R ^>u +vu g!iu̷2|eȍ;ƈGD3tcWlU륪rL41#B1YH&X\cj>vU~t]Ӡ#| ?~D6߉fFV&ك8W]Nb𬐩IxzwT2ueR 2Q9Ah 0w }5|׉;*} I yYVj|FUqK1Lu0Ik51p! Y Q5flaOtUȏ֒m+=T=qK΄{_CWX5I0 fDA!@B$P$! YKB(Zٖ,˶,K^[%Uzwue9WU=0]uս|W]#iy3b`-#ye{P{R+12̕ʖz5oKSt LU'4J HHD/8SQ_.߹tٮ'ʠ H\k[mKy"U,ԚTݜY 6~XݞR⊀uXw8ԆQ#*haX}`^q;P!۱.ixGўTJ 'CI{ XzH5$v@Ŷ~}reqɪcl A`E9n]E-m%f\öDdnO͖v<,8һ(-[JG G.߱?a;^ vLΪXuƩ_XFpnp7_ C_Qyȕ.F|Z;_Ki3WhH7FH7+=/|}P+_G(6RXyqf<Ǽ%6l]bMu[Bgp.0b"7"M#;)>`2YJ.1]!mxd{X}g6UMvv̻=v Dor4_ރ~w+6_7=W89a򥻬=T}ϰ_u_RLa$h7'8Hm[Z Wsg 8|8"ҙ^X]@G & NK`YxVJ3LB$7 ~&&gYvFަiFv:y>-U֍ۓk[UUD]tڥd 9]8J]uom"U"!_l}_˓j͡(lvCf`acfwMzC睫o9znnL^c-l\Yx0O!5Rx)h̵ɐ>:a:k+|0C!y^ǻW;mkWApny(g <_nfn#.9rl46>乗ǸlՑ<O(AP1."0EHz{ "O[+;|r益:_x݃w?7\r}evRC׽$x_I%GCa@x#H7:=K4oM)5<0[af7 "rb3jPol.m{@rDѹWWz(XV;}G Al]d4J5H xXbiIƟR: ~3*'R ~s]KXr4xå]Ɋn-BگXeNgK5nf[Yޛc#8%(r01VYuЌPbn>}n=E`>]MZHSwnԊ١}c貋4u۶-HE=z3Lx'ehNo^49 _!ޘDŽ\8GK*Wd:~R1~8> NL s9uڧhxqGIa?-gxB^> &p) *s a.|i#8D 2x݉-{ضkƯDoa /vq}fq vyF5͔!>x8`g]b9߄BV>ۥvcW*2!ȋ. xun Ml'dOxlcàU]yvn^Q1/Z* O?* izǷfMr>#VLخ'tgbҪIPnTgk_nVj9>ga#P["U'AG;aִ+k&bb'j吳=Bھm0ڹp_#J X\3zR*!(~cO8NC|;71{酅v܀9'j̅)%YhZBIJҘ غ,砓)Sf*4{D f=mB~Sq"84ʕxf6}⟳gb_%&EmU{8% 㶶4cHFz)R˦8_CS-`sT6lTB4/NT]{eq*n  9רO#sǑ" ;JIl;s g|:Ȉ^ gNUPFzUuǟ(JGQHW 6] GzgE|.1g=ͯ*SM;Wlxf57 ?I8gG7XsD_`C쳸+]q^~}DžIQK,ּ{r0*٧b#U/pnN T8̵ompoV SMR( l_*CG8US=,.Py\"EÔ2C"ܣQ`/wV * g$8N@NjYYiiS\}JhFMeϰ  .#be!95Auv] Չ XsxBVYY 5Jas>:4,p=d[,J@7B:ԋVD?'.-`^ܹ96 \?saIFY-!__;}uqgzr7qWJ1?\߁ֹ]'%;&)>ۮE Cl,kgb$AVFe?gǻ4jN#2:DjۛX敽= 5PIi(Cc38aB:|Ә.Q]8.U().ll41u] u8Zl.@D#Z>ȏyyM;_8Y%}Q+T򔏞ZDya:=S`.ވ0 h&oE\y^ye=߭ޛ@pqr 塧 8PPuUYVJXX5֝e`Pp PBx7$|D(Qs&-P)֮ZV9\/Β n>vFkՁ 61&E;"t[<33jwXUᓹ0TB1g OPN`ۦN^;) UsyPgamPbpbRe{DZIo kZ1M&NS Z %8A [H _׭? ڟHXX#imR89\=L O)3CZy՜V˅efncN!hM.&Uh_0lUYs)pѯD9ʈ3O,?%׈}f[·_2zl:}OegP/i5zs/`15{4>4ԕ7D{TnoE(4R2As}uk)RsisR0حEt`)eҊPކǺ-;j {rx>JpJ>0*v-v,E6B&Z(JQcA! v\m$mMfg;]4B#Mhe#XzB+iGS8]I7C6%ofS8wgߴth.BgtjgrMIQxպB9\"뿄:Yߪum&K7QJrGP*')<ۤkj/h&$j;; U^˧9ptE~,V}VV~MVƑHA^s ?Mg0>ې1Eo9f}D3Uk uyKDy"sKGcK:Wq_}-lXp|HP2 p%JL宁M锜;fa-"&Ṵv2C箵' (Z9"bZV?xp >6-msZVz[>Gu<=VEQO*=]lMke2Mly1]p ̎dyV`qũ ZZ .Xz $|dKt5fcBy0&رC\*dVQX:G0z h/5gV~mietAdd6zh{4Hǝ*4}3^cn~@IEz+Cn!=EٌF ӱ{`W-Ŀre2A;WöP{rX@Y@OPF4ǂΗ_묠/ˎ#?@k{~##'&c?4 {E{;Vg]ΐ-ʼEk(}Q39~4_/F/*lAp^OLثt%5 ڲ^+FD~ |(lڔHe6G/e{ܿ%I~67V[Xo}u{pzOpʳ]|r5 g:YW@oD#0LKW5_KZO8&X,:W2b5W9y />$2  sj*(L潻uEk gm\bBKm-g^1D"#,n 0#$,| IKž[ux6,SC^-[/ /~"CĊ;78+ /`-͎~tVU'Gpf{Ks̄27;ܵkX0>u}1=# LJ.WqA~\G3 {>,v)VxڕDlT^q~ Xđ< }7Z;Gڕh"}EȹDv41tr:ů %I}V]CxðcL.SSHN#|7S.Oʮ%C)`U d^*s>$ٔUp\ ]w֑ }pԂ C})fo ${=ͫ{.!x/6p{ikQWkƺIjvGfQc!DFj1uU1B&kl:{Vr iPw.Dۘ׵l'.e(nMc}՝>NMr@ BLЉNjHV7CUoxu*"0?$ }Us5Uo9k $(Da/zxRA@ů^LV%a#-JUzkIlH r;lLqv5= #?$o@olBfE6e{:]Nc};G=zM H^㳷[kecNj8>z*qvybVJMA4%)]+u3 =ڝl9'_{fuL@>i5NC: c:"~o2.eE¹~qZd$#ϡ~;Ctִ t]P2^ei5/VtB![lSpl3MUkpD-YCޓ;xԿGbNG3wm#cbWwsbGSjL;11K=UjWFڥZF cV*gూM|eAHD*S"-/eNTQ郟qGmtfE?% `ƞdѝs-o]n-g=P;^SdVb`DߠnFr/UUy\/E¯"umٞ껲en֬c2 J^.!ט( d#!uA{&wd}qd ,̦&=5y,D2'҈O,D9su+&87r/a68ۮ'ư IįRjE"wǓH0oaamKO |6cΫ$K:1 BDjxcP.0ڝ37tRR$h tBH%cLx>IQA4Pn| 0MLZC Xt>QẸ`<i"oLs"?I &F>lJǘ-IJ!!l*t.GŒn)Jo+D%kV>fTuͥy v:E>4AR` 9xFe"1W$ ,r*aXȓb|(p*zĴ&<"ʥX+#c`e;'_y\N4ҳ/F`g yd.wݒUG$^ꍶ=W52)HjPql`d[ٸ# 2bp,z5H c&'v,m=2o~rac9<"vB\5ml} ܍z}ÄnhMFȦ v;DW;0sypi)k̪W_vցx<߲<[)GtW6pxFu`hG~=RSb7sݦ hʡ 24ALl&kسF 4]P{ֲQƒNIhPS4~%T~4JmcO)< t1qkq/o"eO(a=^,'oWl^q}۶Dg4It \rq=U|>\|ՇZNk\).[Xc~*ndUƀ(%(\{ '4٤>cq˼ԚR_?x3ꢢe _Fv%Mdq9MddKlbڒp8clY,).ABO(e.?k˳ԮP_871 ?e[ح;ްhǟ]Sy*7C;F:h^< 2!FWDUo@GF6HW+ó8v z5D6秦k' oSW%Q m7 .B)HB^'tu(:.C)BvR9\-_tzHfO9R!:pryB^NR+ L`\,YJUhpVCL^=5QTna)ĚiҤbTFőfuc"75nkQ,f{5b}Ǻܧ&k~̪6KEbT[;KVl[hy#b,.%1$6`VA2)q]/? ܄?_/_uf7mjpf|?";ye[bM8 sU{ av Orcbܵr'I+z_eKAx'\ĿK$Z"֩J> qꓱКDDdl2ZbX-ٵqn7̃s(1Q;whpEF` 1Q1lNkb&QT[kGO{uZwbn~/.m 0./y7mhiu`>3IsL#?n'ݨ s!~sKlz%>/&?wz{^w+~iI npOѓqp=ݑ/=X${:y[ܣ[BRwpv^Мe‰ ;k%5 +aۊ<#`I]2Q]߅;½ĭ2溵("w -C-tGAulm7m:KlEʗ":납zّ!Mi4/[RLh~"' TfΌXn\5$':-QN(Kjc+Sz3ΜzMš/ +.>io:;Y X8lWe!'4Pv^' &|/`Gx>yӶ0Uv&bbbZZ)dZ0m#ܐgfU#րv`eFYdb\j]I-}[77x:aix2I]ٟCyۈfϚ0 >|,w>wW_G&,| gH] #2i$fYE;꽡C'}_ȂUy'AH) L1C4]c#iI+3TRYّ.D4MZ#x@ƩT0'A<&PWle :"`̎0v.DTaWJ<.W2 AJU7*L*!cp+V|c(fXadq.aW͸ #pd#K_ pR7'~Ͻ/=x~ozf.TņEj!:(QZ}( D HNj56#A#z47tcQ/չcl+?ZA{p!q'V L *A}=_l&~̫T,Ӳ.J0i4 N # A'=fUia7)Z7< b,tG6N+[&R6&~-{-vYkХq=G`BR"4#SU '/4:V~(s:98Gר+H߀ks6zX+Sdo +˿Ptsr^HP p ib-+2ht !n=]ߢE鲇n潶-dZ haT3IuUXyy+b]78"p`cxUy|@{e#iӈX@$TqjEۦj*5JIyZ9d2%4.XU紘8@ =BFvȜ^%Q"s4(!C1 b<!Qr,AVzVM&^Y-C%F'/g@;khm8Q: ,? ]jVڭT;~ͅpޖhb$Z^< dAoD{0hsP/t[#K"?B>;4~@m8Z/y478xF6 Hp7@hn%ETX?bGmdǨ~jn%g ;giC3bah)ma=YBŰ?H\ƈl|,϶Q,ި];XC\AVB#/Ձ X F&?^}F,:vŜxa_ {ǧ6Efd%%$K_=]ҝ3Nn$+ %? HҊg *x-H (IRlYndw0p0q]󎒼WH1ΊB S_9_eWt"ľr:.u+VI uLvʶ.HYj7(^I p\ b7Rf9f%&hcq @_3??dgݥҁ=Ǧ)-e)D;wC TY}k Q߁ȆШuz{ȱk]o\jsQECyJe$fbo`7B{Bˉb4)uvu:[Sg%g9 |הPQAY@R]V&X1;Ah x81IoܞY$ 0~.gRQ oL5JCa.KُTwbNe$a1zL?'5p3fSk'C3ɝ.g?6dtB-!`M0U[qdÖ:W&[A 3Kx0-S *V)\@LB vMO3ٖ`xΦ+ΨOodv-,e~%{SvW]/-gW|Ӄɋ}替7_pprLv=7ϟVݝMFH9O/L|i :EWtZKXzI!IN(leZA`PKZYBpy'4/Dǵ&ʗSb{ @(Pëmq5tbP [S&ktL& -;6frb{DLtmX4.*:.UvZQFg z~is'J6`#֑*acXZI+$6#[ZNags?GIo }xēSבﳹȺ]x\{T=kg/{pcO{ nyr@Ϲ|~nG 70:j76"`q4_/IO a&[.taQis ޒSσar !ȯȪHZrMRY3ߒ(r;"Ɋ{^9!`>HҘXl`#gXo:+ rMZjpς늶Tbý&ԣT5cY.N9t;XӬO;R lqMR> yc1)Y_a?~O:/|۟{םzɇt;_Hlw8 Gj%> 2P.iQ92Aߋotk?. \y ,nBCˣqKvɥ .eFQV,paz6XsfLnXfbƳtK$V0&K%-v.XCsLam}G>3چyxApcݲý4vT**E`"R A*bHx2Ko%:rW~4<{=~}} "ֿ`[w+/X?on;;_o$f_^_xϾ{dU R|Ztih;Fh-u)Rd!aaZ?GGV!ɣ<1gSM)nmā|3k0*3r_s F:A6rz a.RSJD<C&%uLmVH6pl͋˺[1,F Os264' 8сHd7,$%nx  &B*ySt P(4˨mPҢT З!w;* :b eא 6~n\zqzcH gYw 9ķIZ )6M[l17 7 L>\;\KuayhIt|eUg Լ$tɂlrp|爵^yFQeW8oLS(3FV4cWHm!K c4$OtyA?83K68ۥ%@x]ʤ?' )S%`qêl"PC`{/ |ˈ<@"9F8 ᮴.!`>+j;̂uzu(/:qѺaط~6_j۟316]jm7Gs4bz p?l˙߷fAH&'Z>BxD?.LR_׀xXIBơ-q&Iѯ A(c >@nn#Ϗ`GIp"^migfރ8uz_{],PXw){Kמ77vYr4i9p}'\N{bg*ARFgF$^8trbѷָ̹,mT%ݰ=]Ýv6 NrKXGn`*!>'tէ1:99YB[! _Ak@|w!1ZA(nzYuhh(X;}!XWMSj>^*f8<'gQķo+c5,9%QzJV'ثԵ:ozCVꍼo/>A> y$f^o 9 KH i(rxw`r][By e;nEShdq,p-v*Xm= ,xC8QK x&bEs.%gpc.@-'3_,`ȏ{}uA9*Vq_=:Ió%,Xbߴ=Wvx;߮VLZs plyxP 5r'؂ūlg#@f"95Hy;.Z4qҶU0MsTo`̮-±R 2'M 'BSa?3mW{Xe\ZĮhHkĉSOA+_ 1vUkT oGJihAoTׇϐ(h^ њ9=!٢_֘lۃ)9υڱHT{T *,b~ b٠>2~5^u 75 `VIUp."8TCt[ga<oĚO1+H9ukX`-+޸@iTf扩֬T8vB-Q*wKBvW;{slrWý}e_(x}~}nԞCQEzHi{>as Ë,rp@200mӱЁ\-XF$=х=. N@rn.&ybsd}+H{0Lts<֤*UU%YdId$ϳ Ƴmbb`0dlҁLH@:SI $CN:yZksU2{l[:{ֿ# 3|ɃF´߳'q CRgMIGD!gkTFK43c2c+.S{Q ! Hg@Qh]Հ\MCl&AGv =`?vU#-Իf=)8:9mvmE)BZI>Ϙ1\ÇqaGUP >[^=,qC{2\h|Ö%HGK(B,-T,ؽmI "j ɢ8(ZGdN*y9Hgz{VIRE@ 7̈ & OI10pܨ 3bf#cUuGWnRWx1$x<>N<}}v |.;/7q;{_60Ys=̘l| j)|`10vWTPYyve0T#9t0`dZOȸ+3 X6!H"u?ɚqb rBMt]Xx"4!K܏p~]lmt'lo>و_ TS6O͒q'*?Ibnm!~G@)}%\%bm4j61^ʇYǭGXL(|oYX=6:ulc]G".Xu#b2Ђ R920vTgh%ix&QwQ'?gsE;فy-vw7_ao=Zo}K}z__~ȷ^osg RW|`j?VZce2 =E!++ÞJ(Zه<S^)6.kjf+``! }/Ữo[`;v_"aLj-Ms,J4lM*wqL=y't=lOvxC8ppMco;T̑/ҴnꓵCC^C{W1FI%Xt C3 KHЗaО1Y[[/4Xۂ%aw6y%,\5vj6.[:0K/݋۾;;tw6vd?wu%vCcQ+e§*;kiiUj)a,ppt8ڃT=cf p7<}JBI6] $g8S=9Yf}uGr76;mǀÇjY([QH%Q+be%n\[6f|O旺ExkRZ-X1jkPIomk=pnE3 kX IRq= hB864۩bgsAfG:(Yyc/CoHEfjjzVGu.Gx7;ִsdv}:emTka}:FMVFZHÂԩ8/tcd؅[C>aSu7- R ]ӥcRf J@PE{-C}<`/*@: D\ծ I G#ll;q`!F ua`UVxvDp4X?>"9#4wRpZl6P-4NIa]6#=v5{k8]x\W{ҊKSd10=B؁ 'Dvf21>l+8ͽKZ>q(x/0Gv\g>&,%*/k Kt'b cH.y :fpJ[s0mlS_! [}x5;.}?ҋVfl9o|rY%:V p iMcZlCTy<ūirb޾q#P3 yT|3M)UpN4Q4v($VqQ58VMVY@{IY oFfS̳\xԸhvؠ;Z:UH>̋pˁy#h #Tdwdڌ a:-QG.H6Q.Q8i0uN`CBe^pY{k5tsu&[Jb^^\ OTZ!c|ABd/l`KBrujM';ӋuNW">g6co½jPyŋ*|;G䷏\Gg㵟 ?vbٗ[~{;L8xmgHh7 ;%3I5Ԉv3oܚ[xx<ώݍdb!Tm籜k͚nlnU$KmZ8k8XQoslKmF"w*7epP#a'ei ;:{xq_F N%6oJPqɥ&@BlHC$DYȶyUW+(eE1ؤCb;>W4d4{ XP<wt[`S1<ϒ}lHTE9[ o 0Y2" _3f73Ig]+8+7X߲~ ?ۑ݃okۿNƟkO6ۣ?ݷLZy|&l9[p5?+ֲgU+7Jbi [:k4 cs-^bMc M? =plEM@GE31F#.ђBs<DH|IoXDPmf"iI֮Bj+pf[t-\ , f"m Xң4"MSe֏ȋ{ ,2C揪ƞV͉H e{Da*lE7}M㰎V$5LbK8BHB%u9lS869jB@>cCv]~E={rLO.eOU}3[a0L V_ C>tH=U~%}'{뒚v}9]C\&SSqEgX֗`=TZԥt`A!e F@2W [Ü3]rQd"AC 7;bp`sxE>Y>JQZׄ)R>o”,M|gaeS Is/Ia;*WdS1)J@Od\c3qvUfz Ҙ${ MN92ڡ!_KJ#\:wbx'.)Y7OANz"^Vj=-RMVܬz<**N֜gaT/m럖="1E*j߇}T L]LPV즏nqjA(ٵ"_0(*,ï]t ^Kt%*J( 5{ۄl5 %,plb^lܠofOM`R0p ho"lujPi4YuLo4Il,S`&PakϙU9*)0C݇W={kN<1]۵2%d`w:!6F3Q!chls!_ĕ'm_L-Ǣp<-XU$j8_ie ae7/d_{~8c<, ;-f,ș-o=Y+uuR=` gU:[ _g rA9/WjL)~1jY'r;WIІJlCNmzTչOE&9b."Iݡa@v+ ;F:ر_1lf!1()>2x>m>7[ |Nv %^@wQe,Y) 9ۧe$Z0T5GxD +ʳn ~af L҆Ӯi_pESL?C=9ԏF.Kl+*oj.P%S*He)!_zz5sd)ʼV'.^!cK#0cQu&BuW!2e;R}mnE OVeS\cZ> e yA ot|[Rʔs3HFSVڐ.&Q8tS\gOTL .0dvϱ=ңûw6Ư5 Otets=)qJVVGY\뾞LkA=9(pUx2V]nzUWeпghfo+rIGƠlёmOHAG~VCБ 9Jb*N>nF"!{N6U>l%W")l70Ҥi9kMq ,(v۞s$R 0Ǐ l]^>>L͝u^yOzo}˛ސ}ه/{pWޓ?-s3tFcΔǽXpf:8&[mv|Hmb$JcZ·Gڀ(~ˍq$b}Δ[c<o9k5d}cneD1=?T[ _dK;v!6'^+ %g7\D0d4''&h& ;w=-u` :{ͽ ĄQ2;xA@çɊZ $eI pR\Q>c,jV"nlN7rr.i*J_~Wȸ8B٠Wc:u\4X?v3&jHB>u }d2xunR'4ż %<DJ}NJ~[7(;7[/F֛8̐=fH}:(Kڡx<)^K3ŦdZ.E8Ni%ʰ^ wgon&LqXJFwTcBy4w[Kf {BZOKg[K5{t>\+݌;X23(Qւ/E*A%O\6:26lUWQBLP2O-M `V @eOc4;ή-U%mNwW:)‰л[vGQECAboi{J#1Cp?I ٣|u{e3Nrbú=uE R@m-}0[[[s|- VJy6xUlq"=^1f$y8.(~ph)&!.p~NJ,4Ϡ7@s5 N6-WDN*&;:loK99gn }>ngi@n=uyfmn㬚eA ]/4@wЇ W_3U ^+ dLXey2ROQlsi}>>6Q8RZEX'|dRr00<>GBMO%d'0hTxrLCpagڨ Q$*7QM2X~(-G P_fŒN$h#7 &j#kM{Mc3jE(wᆰm WpA7Ӭf샐1sI<QnƪMT},uNnX^=ZιiS+R;+Y᪚!A^i !hNrb>(rs c=R޷,2Q(w\~f7)`zծìyy} +_-#!1UX +p? DCIa6Ҩ"&C=2@tIihl2Rt>u/y(8=m-vȋHztGh \gegW:uZJ FR2;V##^+i@dKެzھ6tvd'09pG|3߶wOwKן>o.Οn5K"3MҵZ+h4L_.?> Ex;88/Lvuh "R2㇛Ǝz a$[FT%$1LK}$ #!Fm-&ʳlj3zCK7x7$VmX…d*4{u$Pdy.!ϣ˿_g-p}>ʾhJ: 8%w|b,m\,JFI͎]X5J(l[%=*<|2;rbz@EMVRVy3ۮZ0My+]K(*U>%IygSK\ FbA8XX6@J*TBQ *+ $b^&YI).\V,#fUcE\wҊr|G 8;rh~8f:HXDXTҊŮ_`1#iՍ;H١yI J9^+Ax> RhH3B*fnSvG=tɡ;8-2f1T (}ses9S9kȩ?Y*{A;]|O۷DAp#;ѫݕ=P;W&&3a~tkSMaю#,LJۏ<&]$7k2bJ ̵,/!#rƔMDMae1½ƒU.V!D[\n$dy%<ib"4pZ>h-I8v%{#{ΞKŋٲz=g*k KT"GQX|Iat}ŨbGs9%k46Q~@̝ZJI, :bWP{V"OFmktҠmf[T7OVlU"&d!%q\\I>EYѩZ5!YI[)7?`|x m&8f6ۦֶV"Q.1^{tm<0I ;ڨ?nC쵐!I:Nό0OmErďT*[C,(oC ^IE0\u=WhA*НC`a"x+C5 iTa @g_xen?f0JpuT)\)*Ko̜~Dk'"q쪊g5/F :p#h6HjP4 WfCM,,Ik4[xa[pS#9X΀ p wQv{${} +w_>;n{t/ lU8RPH2r^,,Yj}shK)ՇRw͜&vx@\9j'J&ATlI:^885;VN P6aPԆ426V] cC Ȱ{r AH+$oU]ȉf#1l. V;R %Q@(7%w+ʀPCXh>H*4m_&[M VUJ%!'"+\ry1$e4?@\x7BNQ){xۮ*alUz}N1ZHZFMQΜHtljm9lFFZ]DZ)c8%`YW>M`rB35`l(%92!y2~A$P]`tEF%l%8w݅cRbSAe/I$jM>91"𿔏:jB JZWk7dQrFcA\G/5i08i,htV gbSLQSwr{xf Xp1fi$,zR8?ao`?{ > .b s7DZZGZJ10Ey"'7 Qt}2Zca(/H IdYmczbdĮ^ ׽平QȝM[=n~I4!"S/ׅTƸU;~Rg;%: qM^R*ȮSU˗gH *Yg.z5Q\-j7zpvr\01ȠøhpQm+`s>|_ӎ=9Xa[GoZp=na]f&:%P*Ј)G)4=ŠBsSXg==]ڙsZ6"1ˏϵX}4 6,m5BxLZ9'~ܨ^h) nQj`Qg-MiHg&TV\zƺkNV$YZ8"Jwm%ZhIg !ÄenH!(2o9tѼdf1D>CS"p!=09EBdه~><yhO;}}tצ?|ӛO|p/uO䯙-}8uVh|uq^fjX^u|Cded9:[-m#?@@{/v&3lHЪ2e+&BIhABhό*Fv/sn;27+è}KҩG޲=72B#.uje&\VK̊qm 8k oIg{1Y&Oפ߲ Qȟ#a ؍V;$Hƿk;;1{yG{xr'Gz{N_rsg)7hkӳQYF*Rޚz)#1ڀkj!&Kp1ᰑւ͌+]ZrS&4NE5z(nӤ rG嬡dO0;KlgNǷ$Xx|\Z2 $t*Ǯ}?V(5>pϞ~krߠ Yn0rRXoOӏA V<}Ksįr~7 2!4medeUXff1}!yZ^gdQņ򣦔3bF[&\ ̼Es:`OG1ch,bu]ij۲ 8ePQ\ s#XI=wpїfbxm_-*Wp߈. 'Guw bs' |TAՀ8^8ƦQW~cUI#I-ڶ)ə$â/qMvdOb5<0'" 17>'#^8!4ڹH JCllpdK |8_:i_x{|K|?NO||kyY-_z͛g}o]~Ϸi>LyYЈp"\/&FZpj68+ԥhٮjPnmÛ++Di/tR^)+,%C)Аx!)+h҆-b([4^XfO֐fn>MRn M60t #Λ85o[f ZD ma^MuqfhPLTIlO >M70;z5HҾ!{%iHBe\cm( Bq(sx-7, jH2blvU%p CCxZ+?k3M xu!: ބ0?&6zT3,m&TYHO};#rdȮՃ Ɔd4o$|ģxI~fĢBΏF]!wAwiNl2,4P7XpT\Y"`nm>r 6t3ј)&A Y~a`Q1Vҟ /;rvYIėx0R杨R,Bm.VjFVĿw<,$zBa Qľκ?YCTmYnkfr4EÅOiW! \ rƤ,PyХDQp+ϰj&J0i ͢ ZI!Ep+c3g1G%UZGZ^²9-BYvbáwY܏='[,)ER4%M8Ktvj{V)}+L g QZcUb詀UR!Hđ2cV)?a݀@4\ @1'A6 6>h{\Y% v:zPr&Gyz | IA%Gn:Gd4T-8sLUnN(Og8pWlf6#-AcdӍE>uh2i+i;9|fɟ,ꃑdjdhZ66q4 \S[caKd܈&.d OLq煿s!4Ǝl;ؾSO}u=S-OS{Z/%zk/7JNe #Ĕ,V Myhq5R4>cf$v0(ح8KÍXӤɜ-_S{kyܼO!Vu6 rx yj@nŐ1FH `˚#]ȷ%qqFQpTQ'0@⇓&t1V<A\$`fD g_Znېc>4Fܕ6٦Ie(Ìcv9"Y.Q Ҟ Ͻxέs/F2~靯[}փ?oѲh0t&b2$/30r͚áVl[Vyru[zb_۰VT8_?%Nz1=,Bm =\uB!O&j)ZΊZJTq<!7+0WNtxY[nCL2|?q(E_`}0gH'"𛻑W 7JVA H4B3]m.sJNqĽ5 `ץQD1 ]Ÿl)wmСpz)66rwt(j5?WE1 nQA xeuԍ-&BOcΉ;5nCdfD|V8 ?~jX*"8i$7[b,&DcHzK (`邑s(/1!J ?!zFl5ckzLsu{& g1f";0"MjA՚1]UBDHۋױDZ|=pwo wYRzْ{$Sl ?j>E4Ce&I-EJī-ĤS3g; $4 @pRF .ŧG'ka| {p:T &iȉs%RnBzFV2\%mMUh8EoQ^MKZ[޺љ[mH_m.|>v]|qYN^Л,iYZFղ"+r=ՀHHLuBX':1 ^85H]Nn{4v^!5|ؠnѮ2E)o/mj4 T37-ehYI$ MXpa]0!$Vib LXY?5/EB7!\0ZmGŹǒ=sS> cQ;o^(*mH(o_d<0C䦵q0w#iJ/f*Nʐ>Mݬޯ!VDIύ G&{oV$\vggF"פġ;p6F*"8]wTDAK*|vKpJ͍/cggșݳAtZAE# `ۢ6(^ZʕjD(Igkɜ. C6dzo$ &c7[=$GŸN'됵E eW)s"Ʃ9i(5J'Rtt3n6Zʈˢ%:eKG` [³bT'(D\Hs$0"lyѕeD ˦je[0oq4TYhpĪ*Ò`u4ӍN{PN|3op1[śz/B -[3iAŊ7<\B/紌Ӳ3.c~, 7,,KvmI^H7-f +QZTд  ց\pQӵ Ks([MF'v(>GXĂ9Wp vД'MZdVR_QLqF oKTVeו< C1ՆK:wB.e,lf;.?|߭ϒ\ >f pb H>e܎28 PJUۺ k. #pX5W!C|Ǿwq󥓢757uOk{j(0#+ f2;+u'!9LƂ$\Xk,BDԜ`=Ȩ$ׯeJ"rdU ڸB1ǚq6'ƫ3`QR3y4c*^TBjH4} <Æ-O'QQ}9X]B 中\>Լ"鷫/Nű1c_g6GVOfG*mz@D*X˗!'$Њ,_h@BiyV!q!`+(*=W@8'v2Gc2m)#%킶I*-VOzZ}GMֈCvh&7Gc%Zc[2#a/_olN5DmV;l,j΁&(<< ^7{q4NXm8lkm+%c Rƻ:"]7y wlj!"*5ެ]Cwc8%sIŗ~0P+d-?Y!]>} }cLLn ^8x1.+:<ԯ} Υ͓rv|~wl86ʨNSh zFPNT*!u88{Y'oԷŞ ]t]:'+ͯ?zSkf`yAGWsm˲'&TZDQFN* xےG+=3IBukbYEM+rgjY@Re](x "@-?ER +0*|d G}=ž޹mbe!e&]J j`S;s A Os{{9n xdۀc*Y=@R <VyF~ap|W 8*dA (xD謢~޺a%J<} @žO`J /pR*ё!=5yisexa|9i3uYn/UTP*H0mE7ȳڰ\ZWҤܴw/)XFށ|Vӏ.݁N' JIe_hԜ|q;*g 0YٿO2C< /t'SP, YPx@^y-AG98bW7@o ^c3iojI.ՎI-b5 *z!ێ%9hX)5/lQO: &^(pNI8ep,2U/mm8rK'4f3'"-˴CQj}aց+nzC2O0Kũ*c#>i$F݊^`*ڬ!F8N|l_z7.EY`XО@|q.igfAXkD&V$%hc8%tH\GizQalCֆ璽^YĕJiļWR`?,S@Ρr-/9;ZƁkH) =ٱU,LJ̢"ULj*m6>\!@o"zq Q:5[M,6k2RKO`_MINPSݽ_}kq-zxb=۟|߻. N"V~e䷅Y&X/ޜ;54iO n0قfCj{i$d1Ao6?CX9NR6f!K I M J 'yܖg4q%=xm 7V]\蓱X k;F 4ZتQL5SB Pv TfEK6@0f]gfoc@4o*}ģ0gq*y*2-BNy6):U)< !X(bwHEfZS2;EuTgkDyĂV\,&?ƚA:oXʇʊq1`ў4 !Wٕ`d+9 .2D&5]\lAlົ(:gלti6S BJzM6eIrb#퇨h;8l}Ggp4_Ԇ||={V4>es8Ur eP&QR<*^ƶCd;lcj(*R\y܌/YOu\ z:Q*Җ'nǹ!M [;pHƱdS?DrTc1Y5o(vrڷf1\q}d)9}Zԍ 6[(ۉc&oNwp2ڐV̚o5uILByVZKY;21v\*@f٢xhs;,C/۵ne?eEs*A_u絏|VsWNN~sw=f:éA1ulB'؝+8j0Y54+Nԕh#_ ys[;f2sG1͑dxg@+$4Li>tcse&1m-q-#CXFRkt#;]gU5众y.a0v̑Pwẻb`1hVm>VFF,5!s|si,.<Ӿ?bױOgد]][m:8)7?=t`N+o ƨUFldgڤg2oZN)5?+ZƮ֭Xm$Ju3\bjvz7ن~ףLWLGFTNei`Y؅pb- G\gY.0f{[.FFaIU$޲UlڙgaW;oj~N@k^4ch@ZCB)+ Q5:_nT!G`t(<-ġ\Վ)i&L |_\tM67.X7bF/JnP }r5_NY\nWG?%e=%Ԛ(v_j=umeEkGh֬2qo a{{]{ aTC3ôu5q~z'v[mOע3m{QY(%olabtQX%U6eoz 0bWmbu'ڋì+8VЃ(ɇVGc/-A0< [|nRW)!隣:9ydsvɤ¤Q^5@ p]+9~!t/yw_yȫRExV>yQRjR3m5T͕aVAUw-k V2CU>(ncA^cD7'aR{R**qA~ /txjDzEI9u 陴Y `,A\DR-Ā ř+̨n/&jpn'z~` HUQh|/ ii/U;_ b`7=ebNdt ?9}խ_c2K̦ø[`r}\Sicd&m*nR\9U>]Did/Ur\ |4I3y[w_@!<ZiDeBu_?[%aLf,7euɖ~ec~˃O'M_X+ĭbW:3LWR K$\WqwNԢQMnrFA*}w u+E6K\ WP/ts Q*=q~y]gq/ks{T}udXl%[.ȸl&Ŧ! q)7@輄_BB ͽy/KMr_[{}$X|.k7g )_ux\Kh3lV6;87Hqi&1֌kHênJ\HfGHK6$X/a.X(ڂ9buSRTQzl\E+IH!W޳tpmH#[֘`M$JQ z'6?n_Ʌ^r7;=ՓPgZ?;Y9AidPjйB&D($ʚpdp&gKl;-)McH֜]Sq:lSZ2 x8>CJpc%-U/=3ǐrK: HӷLiw,/^ث:&qD|R5!pb뵘Fmhf9?CnND-Ff^Li>_څ$QU݌o'XO+1]겘cLuI;x'ؓl@ox3ٗK}FKzI3)U'sc*CgGuɲ}lx920 WO8pҤ+k$9!n6AgkڗN…tҭ˜:su-w\778?E-l r"T?>5)HQΛ{h Ӯ@y[ 8OH\e`k+SW5.r}aӊCİ .MbIT^uװ\"yHE.]J+/LF1Pb)=lH)?Ye : ;EԙQxpbL#AsM\,V6upZ'qd6lpLbKE 6`r {62~ћӿ;uQ7@2]O}O>qօKj%"z!@2P?jܓ;hQŪ>zum=k"޶1ff$ɚcX sPqv()鏳xVcXZI5 N=ӊ}b}_˸"z3N& : L$|Yx&Sam"Cɢ_-6Cd 7q4%8Z JЪ"*w+mQ~߹Csߍ fBb% j~ny_k+6:yyk-J$Uߺ> vZ&5!މvxʪ%euseKN;}史Hc(INk\5Ԩs|.e ipIF,4D$kUw")qf⶞+ +`(?|K/gOo`]Yh('͉\?hWimYvgVY/>D'UM<$[(@|AQq6~}l^8U(9L#XL?1 " jA0 $aIpɘ&UG**ER;,bDi8҉8]IzSdBRkִfklvuٮo9Ң-C,wBuW涎h뙯=?W>mKGm{=ݳnKѷշbk=]>L8iv`@sB>\e>rw2Uͯ> YV  ǴJbIRW:"hE:X,2(@1B:&x֜'Dd Pxnߥ+bsgԟ-esgؙf^kP/- UP} ٖ"= Y }i־DZ ÍIC4B7KStAT_mN8 īHۮJJm`gcM6E lE?d.\7N/?t<-teߊr[M{IǴKy(L)_$U-D?¨;V'f=)Y'"|tx6\ [IFmeFX/cq^SkGD۵k\mSTIT] (dRkh\J-+딼nP*l%4Sb3sRon!ʣ2TCN6KYt LkJʉhM$e$j(s 4N1j؛r+ 21Ê,mÁҫCe+3Q<\F1+-)a;TO>a{|O77g?Z{HdH3$9*X^=VY{z~`E8 VjvTtb]/\w[:aQ֕XjOhTn0O1VL1|U86yE`X %̡D e?[ld]'7I0Clspz冲G͆$/΄bTInHn؍+5J*e#3tsޓ,Ӡi_@ b!W?[ܔ=SQu`H^Li~~k{Of8W-tx芛CH+LHDAT+]eb?fOx?՟yCͩϟO'Q ΐGGw*X0Zݡ drӫ0쬶VU "v?l9 mr$q( LTIc6ru`u ]V $-{pҐ[U@`A.jF10] G-D<Z JEL'jP@8=xgAXK)X}ԱV!jE m]8~?ށqYSGo?oׅyǎ\јlezEOw{CӓYDP+{]݁<9>AyjؿlF#vP1cyP=QҲ\}^"GBꎫ6% 0!rSPRZ0harjhe-[N%\faA $f%u,d}S2ƎZbDډ\RQ`f~, JPY$R2U\[)ΔXS47+USO`/Οj$Xex:DT F1v8eÈmcRenvD?ITÊ '6a-OL1G g#16fK4ߖqeZMEh!o-xXdG >w=AT*^vngϱW$[Y Z{gvG/އ^y޼gȚ|O03_}>{h_.eCŸ`0'{S]!R;\oj&gq%Kz'MzS- %ᩎ</pFß1F n8+*%ۄuZgAfABF Iˍί .gWF‘< 2 Fb#SjTx|@veE_h&+'!KXm8HJeZ\ũ#FT`p̐ }`v|Lؐ{&eDk'{'{?kdٕ3e܈ڡ7>ws}VtP:+Vĉ \e?D@ir]m؎p,.:p٤ *2+Ȭ 4DjPM,[Ə /㚴U1 \.iBQӶqc3g%L9Luwm}{@ڮAS)Ǝ0,4ގʣ]iźRhpyhhVy:岫K߶l 2Jcm;ݡa{NDI!:+#쳴u׀?'3$աx>NmivxDG`VT --[2C2 9 h#mp>1D[+bk.H{,oXj rbWZvP]'XZg#d', %41I ‚5%A*Sa?Pm@ R1D!R+T,+uLgjI9dj,.*0*L7h$ pHir/i=}׋ ux`.HdL ر&}cׂueK??g9_޼~/~wbENuJӮ=L֫o>$`wvsFf#}|/?}:`wᖻt f%OSFjB'8T4 +)r,/Е)NMhI~ ip [6eG+ڜ:LJ_s쐷r/؏d)(h S#V;F3$ yH"c`{XȦ0|uuj2ZE]b3" }%'J׼&|ױ*vFrJ.Gړ1_+|jx^1L\&JC>p8-N<>Z(9JQme\?3TF\D*Qי\*&yb4jRe;}izŘw|b@rkE%H8IBN¨Y2x:. ~׽ p)/͹c:pJ=srձAIΓQ zcmVϥS p s utF]8fe&IPxՠo)WZ$I$:XQ <>MRiNBbC&fO,5׺ ѥY6oޑ)=CtNtTqDiץ) ]Lp:LW <#H$`o']@Zd{*oi>Vl#+51:勍ћƢq5$#L=,ZIUZ"+߉s)uZ ᱰ. _-pQ=^Q]9Zk(j6]Em+q=JNx +ljm +G !;فxYzw?Oۗg/n%nwxϬ-/qs7ӯ׿(c`vOCӜhuHOe+U욡ee| >ꠦ%t;H/lu=)U5eE2< I6|ڜ^\(;Rrג)YNNQS TlFk.$sα+bL,^'?$tJ|Y ]ֺ.|tv qGv_Re#GN>pMV'CK؁16"ٍ(),ǠAOʙrX!d\v-#AdǸ+X*AQ zY"ujlxZFE'_iJNBAޢ pLWI\+ŲT6z5|?3984STARK׫LMmːБG܁o{8*q/!\Xw҅} {tZ4m tK {\vc>}}mmօC@q|V}ᢝ{өl8_ݕU~?:dޚ.l(}%|`)H V f%bDFduѷz3ؑt4ru%/ؚWBFmq,r\ꂫiC-?~ +?|upCJmv=9M|*crՇ}OS]ϞF@nof̶`ϥ}Ǹ F7QZ2m_A!g5\:\uR{/A6 /-Zm?q+j/oc 6 k;l>fWkOVz<+"Vf>+n{ŕxۇU>t5X? IwJ/+t :qRI8_W4O$gA%,aq$Y#ʠb0-.Kn<n9\fx)R`iLa)i/ 0`_m^XƘ=L}^wX_^I2ҰN/!-ZDtfvd[Xw3 4]ʼnmWiX{b-{6"eZgGh}ybx0)s S!}H2j5YC.#n49m1c DiBJ_tve{۹5e=B|ʺrm..b>gYQ??i]cNmU_x^ {<_mjɀ;BsiýTh0eyrMYZ^H%%͵pϟk4>bu}=qT='oN?'۽h}ͷ~$9uxKP [}|2(S kWc۶ʶҾ{0D2 /Rq0ߵEІZ#v`lYn]`X, 1}B^Km]-&{F053'+$N 7B>Sb׆E NCGl[=6:Zzdp ajRi0,J6,k |'ҢA|ۀ v(U8vqնDX*c!Q.`$ףzQxgƘy1Ѩ7CRQJ7F;V$@Q-j&6\%ǂyd;vQt6d. D6m_C#v{>6O}pm[w!6c7]HmѮOuaa9 te-m_jކUO {޲ ڔVCނVŵQ9)U#FV+,tr{AL p7 !U1(/8ñ! r!v ?ЖhT6`e(Gn#YvjmG,J TTX>r S]\qf5b}lXnñx$HJx\VYX7.Y?7$Ii)p޺"ULG?Dⱉ:\zLZ1;Uh.Z#3 v&AQgz=Ǘv,-i߻}ߚMp#9fR/Tf"@՜\Zq.>(4fՁpp. W TJH;#;On7#PsCڄU -̾f3b\,jt4H˾9$]$z(Sr,w{B܋]Nc<uQA2xa] i66yzkۦ sl3.zMts-XQ6bxufo6mKiթ -{v44a*T k>6dnmfEת^#U,\v UEKgb[\xe.k,ָ6`J3D_گ'b[÷x0R.q}KM͕Fgz_"|u%+\~9b=Zd.VPs c*qX8<kU* ֤G&VLx{]͎=ڿt ~ݍkj՗nymxёMjC]IH;MȱANQtD_*aR?)2r2u EԸU3U::7RqqZNy%M6n6N\dҵgo5[ +)fiL=RC0R{+~#$_CG}vtm"%G s|O/,.(W½ikMQÝ=V~-Q+q oww=3t'6LRE2[g ?,USqoZ^ɜ* MC_8aia{{džn7̑CaQ'Z$ 7hԸDU=-3R`dd| cOq{ ʊzz@5ܛC[ZPƒb2k19N`(q%qQ؋-jHB[_Yxc{]~{6j[ݷݱWZ>"j-AnO`osmƳpIkF#(ɏN&ϒ(.ϵ6!QF&[iace ۽CU:l]p!K=9fq |[؁cB*i1[t մwooz&Q-ia >(SvccD^kǴ W@آv28`>`1j^-dQ#u0{ᣯrז\aGgwH;Z:DRLO+n# PnPS UZXH {xB _ZG'lc`_*iAfGѨ81F7F쒧ƀE &F@*iڳƬ!)crFlrԦeuʍHڱQM 4eYiy^*lt7oA{M_W} w>7<|WN&z޺W\}TB'dX:|Ms*+>[ƞ2|H+z2Yȴ(x`v<,ppI% +k (fBA4hɈ]P#L#԰2:aRJE]fhkSu w i0#$' I~Ŏ|T4<sݰvk "uq򭀊niպxY[=vkշ%w߱mg_4tvOoh'z_^D ^ EVV3wMR9v썀6Hru;g''ܪ UA$v!^yJs,L:X/qabEۼ{A`tfiu3w7W#{hC3D;JrVx/#'_(}e?ƒIikDh'1En&rކDI6e#^aF-q-춻0>z/tB4ۜ$9&i]יHr5q7X]Thن^4Koj_>MD9Z8tS%Qv+3%ĚXCK#WL;D" j-ً' E0 1eاKYy(tyg|xZ޳}Y{˻r{JPݗL8S}ne![ng v,8|eο`+.`xvx^xaۥ:CBãM Pys:A]owY+fʭq3d/ }<+p12e;cڸ UHE^8xot g/[a+>ݽ}] )%]g:kgǛw ;pj\NOb+{TEs9[BgJ?pP7wi2N}szтW? QNzFQџ氌 a38UN]+*+6f0!-../@B(gC*;ym3MJ%LHKw'uoc3Jp|^wG\v[ ["p,ݰ* l4Ɂ%#-3kp\sP+j Bb1di>9-,0RaHT$ 1\tsņ}K5L;IJ9]H̷{\>ۺF KY+ˡ& nRZFMkL ׄ+l Z$pu]b.ijW٣wiIWo^{Sﭽ ֽoey6]o{ž|6wƗT i*!^V5sG6sSOwh@⹙\k6r G5KRԴO[H@b(2!JS Qdh"G k/p=jo`E671i8Y*^WԡGixNoɴR^n)5,7!¿jZW*Bf;Wu,[˳2&X씆 +#3eW4@$t-@VoqGrU|9NET+vݴo\HǬl*h:3tD:!^9wQ5=RMBeMvrS8  +,6'ڲۨDvK8@P ]p]lc9jIM54oc*b;:uE#K|9B|î@ׅb9cjcVx$A†|vnz@鴗qsE_ΊkRhe6l7f\ϏC|IPΕlY>wUaBIqOpf܏3i< VL9ɃGDgdzEXpC JW'UfۣP?5 !?0)_}-'pu7p WS 4uO-=zf*z1{\[<Vw f^' |iƫpZ>'^BXD1Bݹİ/;oqA0YUNjȤ'Jd1Hɑ"B,{eYOX{~~ou\)J2_gD( Wh¬F, p~Lkc4teeFEEͪA9f@3p׳C~w hD )gwñE;?b }5<,vdE|+Jh^\ՓE!Y'my\+ÛΘy9l^a'vO/u.:m^&=MSŲ%d+<\g 3N)g[dIXɴi߀42l0@OԼ =aΛ#6eYź* ZXՖpA4)J;CvDVvb,!W*IWG۵hqpks}w_9061?ab=vM4)]dS4Zq CL{X)b6]}ܸ`4ClJx ~ (|AsqMc8$TRmk[:$X[8~(uz\Ւ:Tك;Cwr/d=*UJtwRs3FT̰܆k3N#oE#RjXp,Hr9@Q@ o`[qN3M}b[}+JY`*8x1nSˣeњZfʎyakP 3Lu.Qnڃv\>*mp(]q|T4 ֮#ݢ9ALoC[ȯ{>cPr}p,u0=5 dU:=݉S_oV<-;-Y`e۪Lr0i |QEoLGW  aZm66'(BB_=|#s07-*s Gت$+hԽRj9 5L,CO*Fژvȵ;Nk# f+ULR P P,*?dGmjĠAW t?w`7Y;-tۘ;ѫr_lt|,̜mj~z&p!S;f,%b,Nm3YE#M4l7+_$%rx]-X]kZ[a9ZH5I~ؖ2 p*ݻwQs!0mNMBZU7 ͋lZ% z*&/Qȗ}&5N2F8WĵVu]h$%:֖PnH"I4[E%yg{}N{?Js q^5k?EImz[TVZ0w4?j9QTG 7E\em@_+C 8p0R$͋8+IMYG#ޓP0o]H[M>X.Y@úuyed֌sQkAFƲb,ak\|p f;^I,1;2sm+ZٴrC}zKoP;N{";U )C=l$aׯP{XQ}mR*Jdd9>*cbhO2:;p8H{kw+K VKJ,JvGխ1nFu0j+ P3VڍMM)Ƒ8 aTⅇQRd+iK/hsx"+n+0hKcqNLoi}(~K~DO'Zv@flme:I;yF#iئr3uB A7ҕYl[/xRdsCRٯ4GjmɎ;24\oͶ/ ZI“xTtEf=J%T%gyeĔt` blh!^= ,7xp FU^#9p|Ec%E&nũn&Z0Ra\5FegchgYE#b9yMo^:'1}dG])VFCq|U/e@Pں\!yk#+rg1֨g"+ d4,1&WE,w-3J蘯8 {(v[4" $(5+6e gJTXïb3dPA9WO:4{"xHRRt(>V&IL԰8Rn\r6"b0[Tgk+S?@pUԵiHIPU))`cSYLرe'1nl3C*8a#6o"@mLi7, 6Ԇ"Ũ2V]?=!KL/3 F${LiY(\؅㲻%_ IEEg.@j7 E$@Dr ogq#"@ voMn{(j5GMEE xӻH9i}P =GI]uY B% i b&9Г`+ȭxW\7\\sF=rM?ՁQOM8K?<`0-.ZPYP$߱|Rת j6Ρ[l}3<0'=inQ%Ep,yn1>Xm> b)&Iv硚<T M֌%j'K ǭ *',Ӧ6RZ x"W&,n,]HFt9M [t+ڇx&d_`_#oڞcMNKϊץN6cqm"dXs[&f)vKV߂]+Ob Bs[aڹl{ hKix+k6G3,C/}_ݗd1)?dGkJV*v.660c(]IdX"reL`k9~ƬmvL_C-,( /op0 :`|doA,6 cqӡ47I={Ec8|_;0-x˸ZJF2nnؖi?Y7UER/>z $>ivXl*wb(܂ =KǠ{ZBbmv:6[CQ!kfp:(טq6Z(* In7Pځ|{i?NJ<bٟ+༤>SŸ#υ-{2UJt TYܲ^(|p&dN?bY*?29㙢 b?!r-@~ԅ9d_#{=_R4 g[߼lZj4,C"帱*0]ʶn2lY* ;N{cv6Y*.9 G=s.Tv8"6Y5 QO-MVd H&QC]  #gD|ޒ3WZ?䘣p.exvp>_&c?Qg gyZۚ9Ei tYjqkaV`:{+lTdw:߯bMnY?!Ys?<׼5k^zꙧ_:Ǚ\1~,k&B T%R/g++ 4gn8lO# G mGx]1! elRV05p/<0H^cY=ƼBŒ-ZI =L;19!"4w6ΐlvC9}j?R<՛SFE۫BH!NlFω:"jf׹ 1<vӵ"7>; d.fOB 5=r .=z7>˞|Ӌ|ŎW#Vg6Q^%cu^M$mzF@Ӏ+2e̺JӍ@ SBO#fCSF- $t_h,T̄~;4^HlH5Vg%6zbP(A0GG0[{ꂂs]=Be7Kѥj#fNpK[,z".H[j[ MעU=a:䏆N0J,KM_EVp0PAujck=TFj[P,vםKMHz>h3;˷Qی )sw,x~x-Sݜ&*2'P:H* 3jFh}3aG;az` 4g?jIJTå#e,j(+-˅o,n s/ohځW]?`Cv1<}'7?}yGɫ>#UR_.U>m,r룡ՓIc.gn+ Pc1‚n ܓE~<8p G5sΠ67hJ9KΟ$-H A144(mj5g#l9"F݌@($ksŹ%)d8循fx܅CC`AQB!)\Iϕ#EMH{Z7V]tiE/"?PF;<)=k{ B狅FR/;ID;YAC.;Y{> W_ܹ3ɻ̇9=?OEϟ='ڇWs?ufOy0B|8Z9pټ)oOA6G9?|e5 #턀b"?:p˯,N1jqcDd~p! 6V2}7 CYk<gvF4F ]>c1|Q49Al)sn YLoiG&*D̃Ձ ¶ټ nA]b쏡̦ڞd=b<+(43>V6ټj#:FDqv}.= I"MÄFnAT#-.,G[AV~ lse \}nzu84l/y?}7=v/p駾!=udMU'WQ ř3FlV⮬ &>,3guyV -UYy~l:<ba1^ޜ 6\m ϴjʱ Ų`Z (|<x)thi)ӑD1p4<* #z \B#9ؘvhrg2CWe ngߌlT;=lKû S5L*LۈְZ-;GH*@Vs)$΀3`a/agkC`G>m[߸]g<pO[ (T8*JO~Py/HuoZjb\4OG@>nO@.Za_2l9X|3cր40pb#%~,0#&r>m(+3pubjG#ؼq]zXn L^îg1Yx(5%"Y=~ `6 |䇄WZ` ,2ߎ^ D8JWnHuY@5O:rfa~Bc(όXʗ+)oK}!S%1al䝧immr7c]_rQY`$c,ǢשhUX6-j(j0& ."2;{쿲s7֓}U~^-]kצe~g}yeg_WW/>-[YHUJJE 6>JdQ60 ,RD!*}Yw/uIuoMPqdTP ض81Yd>e"ʼnz+)"ô  1]xt( UKm>nd@q9^jˡhϘPbuɟe7vIJEp=[v[Dv2LND/>feq o 3W(&Kǭil) ί͚.jB^XJ ,d1Fj;.,V_u5լ_>sie إ. ӟg.D9LǽhQ5ؑ,QZbV.*ZOuPqh(Pnn>=CˣjCVL _8! n)Dy**knl;քC Q׃0hW6AtN-V;;}|rJɼt;9ㄐ =:ڞpN ~h95"&N6Ə=Ė tDu$":Ͷk/_ۆ,_R!ҭ[L-v3 -$a|H4PԐXiba#ad >E}?=ZWA=C*mbQBZoJF1-45Z6jsȃL5ʋ|?@Dv7~CYhpFU 1>n0c;Vcg͔l>+EJ$RuEbѬ匯쎰Y߳{jk0rorxnȡx6}z6 vJp- B78 v}Q B^T ;ẻ|[R;' ^npvl}E1.gXmm*lB>ꜺoU6i4 ?c(ܑ)i&TQ0J&Fӎ|sqHQ8]HkCP{u]*GKe˲Dޏ*b,zx.N'MFd-#ǟB;nc/A>g_}q=8IJ߾\[]3`Xq]͑Vu!2sgX!ϓ(4C:|%ZG#S.1B(Wwlģx# 1FO5Dw -r^%v! `A3WY _WڦgZ=$[J|_{;r ȡ,+8.fYcJh{l%܍^6%{y` \ v;Mm96&Bm7gZS[g8qHu t=cvzIqӾ5 O]CՖPyO?y?3EAJ*^J$hݡIJx=0A}ADC*|R~,#g?uu}j*۽8i+qczT Кj2ѕlf4W=H#$bA s϶)ײM]b76y~-\ds`peR ?OhB~"Z@mѺ5?QjЌX|RX)7qv5$k8J+nCv%Mhr`9g[lvڅfB>5< =ǢL6%7w;rcaˎ{u9?N%ڐ5 m^_>>Yŋ/;?W='^)̑Jo8utKWNv\î$d2#ODxTmOJj0fUl[@PG7/lL5fS-MuB|nOg3[9rZad; HSu93iuJ(>klbj@A|wG 5:<:WvT wSL <'V29nb۵qM4B9(tZkx(S@'uw F)|겱2RQ\‰5WBku7v-^>шQ[KnFMHP=dF#">Mc ^uҠJV2m#_Sd#I1&z+pOR)%7cߘ0H~|AiFQNn]˜N>w18,i^8"4ycXOl#XXz2V3%`,ʱR!@6(1PmEy+sHޯtXg ꂁ5ϸH^ +8+[yQjdw! n8H³e̮Y2hhzTSj̗IH߸$pFe-SԚ4g AX$L˼ ޹^~!ZS$Ip ySn8^'8+;TY֌}EBbl)8h|xYo<%!"Kbˢ /rꩿ`?`Şn`w5z!9yd{omZsXZw\(MyRFoRS%w@ jj[CzN`K(nc%Ն˽״WJlQMm){$Hv a7I{7 CDR1dBjv&pZImi[=N. bIy#QBay?X5mƩwY s: 6͘9ФQz=^x Nc듅_;XbQsKy,xCĩ\A%+/pTpS,2f9An օW\l؎~TNtŭ9=et"$K=ꚋ/;\21@JIĞV+,BqyI3ѐ֌_NOr 2rҍԟ$W@ޅ.ܴՅm*5W;#NlZ- 2yT?!{-퀶Z[xN\SHFOYyBQ eiV-;FP GL"pklenTC}Ymdwtkt6r4NWy ak/[EuB?(F!H1jWag؟TgytV > pj7Jng4.'ÊtFӨMn#ݎ ټ= 0I!7 ܚv?43> 240lv-$qo¹) zjr+`TNgsDKBy@m'gE^z`|Z=W8 K^77j;_>ʹEfqeT9wgӝ]0Wir"Xq;>>폎a;,f}wQck=/XZ4N6CAǦS=7-ɱ7`[%kH:V0*+eO+g! dQ>q6Z^g18 3-Ea5!`܁ߢEOڙ[n1:N{6;ۤ^a4ULtW{fi[ tntQ?H/W7a_4\psƙϝ4׫rYEݚVH `>ؐ?.$pE+ً4|u)D#8zDҍۺ" >U8lɽ~TIE)`Zs9gAӥ^8t2_ pze >TY^iwmPs5()m){. vԪÑGzWwHgXjOEL,Jq]!b)&J~dQJe${ I&U?#+ר醦C*g5r'P/f"bG6Q\^՜=b ʛ.G\=mk${gI*a+̎ldM*kI0k\5(Ia7 eHr[$A!1۸Y$nEZq. 2JD0(kTՔTuRdSp^! >Mdo}pL^1MU7GV'YcK" =+LsW n@u]^>þ^=pOʙO溘̞%-2ܼaic|,7~H';PE CіDmdĴֲor;ۥWjU,7$'%Jat"s腬w?rDU9N5yPL;=A,7[+OBVhDJ #&yG W,;PHY~p21eZv' 2(`𹁾RՕ"0*;yM67TRO.:i8Jŋ&SPq aY+UNN9IfMP(q00p]>܈x=O'Byr}'\s?KT$tTmcg!:~+(j](1ܰ~TV=29g`$Q~[#ɞ7#xb*PWBC" 7i(T0J \ .F*.d'iv/,2_x$NDGK5ӗ\tg+q[qTO{ O×Q'iU>hi#<|wʶ-LEԄF;- N4Rt>k4rYj4*6W7ƻY]Ѱ٠w؆CW{"X0w;vBH2Ud5Y2ٮ{iM~lR99b_/Q}Pjxvv^¾bYvHw5}yG(OhCMRgG2FMj3s}䝊'&Z6³ѿt (*mjfx'&C\9x3evcs,M7em#|ZuxdtTH>}idczb&Rz(av#VgxQHMY&-rV&Ⱥ'T 9X}hf%R[h%ǩ$ia)'Ib7:ӑbTP8pQPɥ.ypdm']<0r85ҝn8y(Յ,+^7jo@n@]%Sew/ö4ifky_oʱA؞g8 8Qɩ=x9\>B 3wٝ쳴q'yQ O/@~1<ΟʶX&5FuVحaQ'Fv71sT0N&oű+": gT?~7*$[6a|EC"?w.I$j{ScQjH;֖aY<S,PQ u\W{+[$^A`aR{fӝܶyϴU+&MxFx|Qtۭ]LiM^@jh`çBF N`X7&b*_A m*LYtJ{v7Z. 0Fw wo\4EY7U=5~6{{{;6x[Gّ#P wGCD),c/U*bO z vR_e97 ]}* /sHoʔ]JJ-|(&gr=.҄&qA9k-;sܮcxDڀ9lLs2%.˾a{wrvvj)*/D| ;+s'=niK O+2` YT=;h( MUv(5nm( j`yˏ1W~B4L@gI7y C~[:R)<ܚ96<]qN-o)x*ha~[+DuYv`@ydV#KD\Iube?sCmޒ _B@ͲR5ceJsR^*s-GڽGYi^Ͷw?>"?jp?@w.6tz0ܾ4}H.n5U+DVT⢿%` F]R/UIqˎnoJQ Tv5=^yn\f22#ȵG^nOGOeϼʣ [s7ɯ-ώ/zQ5/}ŞU6Fas/mf^2=XʖVQϯqmVɚbm'ųW%Œdql47b-dYTOM>C1@+褦pB^ *yjt XTPP^%Fk!n ~B/+M錨Eb^yv$XɴOWL%x'{!¯wlpNȳJڗ8[:rE[nXq!aXY<; U ZB~ڐ|=Kc  ʝȥij, ʋ OlhRA U4 f,J[!>BY⩦-1x}-r{C=@?fobog?y߲v?zKYGeGW1T &MѹPapeG=]ZT Y[E'Xeq`hךScmG6֬Z"+PډmSߦ洊}SV@l7`9,JQt7X?%MIw 8šB`:a`O\kP _~$p= w|7&q +D9|ܞJJC *Nj3"wv!+GTn&P%YP1Q N 1_ơeCAFH Qϻ⡡MjTR)σz稳C8;I9ʿcݓ9vDT]ho c,> 0Ո.|Q;Sʠ Jk 47HZ8,`?g?yzmgaŝwuGn}wgη=FEYvy%eQqD+gϲZ=}HCC`2ujNh656x(Fݼ9D|@p)t<3tP/08CC9g r/`yrl?4O8)/EjaR<5 D~|?An9w~2u,@\S0tEYaVZyD0v9 4Z=O#_]#Wq]l&gT hɁ#c=֐>p?#3& ԤWrCy:[5.%Of`1bv]OlͯCšuIuK{ؼxfgh߲J0ңurA} G-CM:H C B߅]fW8R2}$ClF;M/"~Rȇ5M1ւob.Xyv# ԜN!lkS)ʼ򰸦]j˨2C\<؇L&E`6xL r[{h;ra)KGsŇw%`D/9mƝ :؃F q*=Wke:x= wXM\1J'F:>}3[1NEtsa` XwEUns%/Dȴp辝uD$Y3+Oc }$AA~ @&CX)EH- iN{zfڙd7˲)G(%{؏=WqôΜ^@=|Z;jn,@HJfݣlxNZ>SQSdKC\U.J\.Y#m"b,# WoR8PAcF?', "W,O#֙ВQU"nRbaj21Vӣ\R[eaUaĴ!˼ۈӂϭ]f,_x(`֒$E݋p7qݮMՓ(7,@PG< 1CP+'6.Cs?@:F)}h$t)1~`!d?/55$]YR2֥q3;R3Kyt4vF=?qH#kI W ">hs.+zI%_:hȹi\3FNMs]SW{ZT<>DX8bPF!ROGaS7=_ؿg;[c`8Qe-m󐿛|cGѓb=׼vb9*7IiF=ֈƣL0-5IwGBPY~~\LP3,' ybTYT{HԕT}r+Ӧnhw'DG&P1E6?t[HzI⌞yk`Bsg/]W⧗N 15cHO{C=:6a0 ;:il8Di"g jlXtn:L %ԟVuST<lq%;맅7͖klal+.JkV4F ȴD9DGJ9>${ #K:dgw`ۮsz[SO7ړoo.Z /fs蠄BA*Ʃzi#\KmTz&U#V;+fxІ4N]dtԮ[{8]wܰSVdϮ 3iKgA>#lM/CPgZL!D[J{[呇;G{Q^ 4#_^' Z4\IBrqJ:JB<q692/+ޞ?4=x&d"k!lnc wٿw}laG_ϼsd1rS]UMFΊ{Ur> bL؋\<}\e+jXl]鄕c%FgDV {;S3b@DPp_ & s-%F0dL$9} b6}RAQ,&-Bٮ@fTpsފ!A:{a  ^H<w˹@%;OQk՝^MMBB=1V[K6f%){3[ƒŘqnӶflj,bdeLzŋb>0Xt[_rB$!>KmoeO̽'k,s.x\}::yF8'*N1w8` X98LFMlt;]$ bP{؍ݱ#A5eе>9^8>Y|/Nh#D0-짻NXU9KG֩178W9HF'3 A&R :!h+7Mҙ ,L <Wשq'%3#w3YL>tK[>8*Jxᐹ^h>#7ފGֈR_ ̮#k\CE#Chw"+-rVZ}=2cȿXcW91;r)-Ck5iߘ)*IeZ}űBz@<`2dJBxZx5)eFka+l,O `7~Fɻ{R6Nv z?f޲ u$fBN!? >9K,}bIJR _YAF/}sD\|uiw1:iS5(s<WpM#(N*T)َ+ Շܕ t6kx[,":nKx3,nk.)=pr將>W8ܲ"v.9.9[2scp"l!S/YQ^o0@ݪ#sjO5q0l i,ys;tH JK1ߒSGK~72Iek6gt'௑fic+{Jh^5]s>UNl?5y3*flo[(EI)>/_o1?`17 T _ 8Q8Z8SuAR(<'%Ruq(1'3&m>v=DrvɝYֈUN 2j]4/:9qť4~;L*sGHvkYN3;S~;Bww.O"'?S&a;t~x% )R=(XƃOE5SaQj# ,TaV]3Vj0f8DH/|pH53L8b>*]aWjUA' pS#&P`;{hn];Ke=m>OgYkJwmdS9 8*qG ["0XNy@o -#>ȣ(04 ֳuF/k v#u'[1;YX*`TWXiL9qp΋q f)Pms%S?2Xʻ G}BP/J2E_ĄdNٳ8^~5qC"q)ݕoRprtD*!2! AjsAl1bt#+ pJU{ᘮ;eچ|Cl`M>wع_>#*X͗>랴a@/) aQeG3ukNͯ'5m>od9Rq4҄{z/Jdlg%=mB=vChNJfi՘k- (+j3t./)1dav ՅXv>r֟?;Z@*ktPF2XbYށ|)\tq:Qq$#aH E5DNq=0T3V'8LvMٝ78 (׌v!R:`y vބU~ľܩ"ܻ̍HZjº|w`ݻ=цF)+\šQ6AVP ER_/m#~CPbAvAv?\80:**JG_iQїu!b r)9&vc?D ~+t.Q~V4Hz_~k.zV~\^{)W\xYXpe۴xzFKO,ΊDgw$N6663qqYkT?M-n/ݖ޽lc{! a_9[L12΄;=,# Y5D٤Q:K=.'[F'}ײױnXV{pW^s}W_wcwU|]lN\. VU h`t1RӦW"5؁H1r6!!K( \^O[~<';}*[t>y'|W\ei PJ]FEeufoSAqqa?8QK 9.vq?5M`%bYqD`*{RkUKbǍA)! AAl &pNCdk=$~Gvs;=g!&` !J5BϜF ?ӞQ.-U  K$ 56 ,F7ɉa]v="L6 ujvB/OO.[A6VWaD=>ȞeȞWwÇNi'>: Oy~?g?wO8SUoZIAaˌ^iT̚VM/w+`b:f՜2#A6^ZUq$RE]-Xv$3K$I;~omv~-oh+Bng[| innws X'w7 ǹ_xg{[WE/- bs^V5Z-3I΃dz+$=Kpݏd_ \ &ːUfo L.<E%K'n/*B׍iŊ'oTIZvb<[5G6C;WRCh|V_ _ {|u*[w,P _D8 'WSxAFKlq0㬂¢ "ʔ+Ҹ4hduPFݩtM|K-ᐃM*#v5= r>UL^2Q}-44r^~@m=8ypOw>ONdaoNz gpFyY E)S!2(_99݅{SˣIhi-7Y#]sԹINsVt0bavx"d8.`\'YR'nf&=?:??wV}2t=~+`<"e=a䦑 EA*p4Ji6>~Q|AP eFW([+tSS˺r%&b{M8m;MvH;ppFͥ-[:έӶ9~^*d~)L;QȪ źF[8épC7K).rb?C3ҳ j˜@U/RY+! >N"CN<:p]U x3)# rQI~9U"LpAkL_V€ äM]@ \V(}(`H-CU$CBN{;w1e09Na^ϲy/`װ[r^efDvy4mm|,k j%Dnٔ24 ˄$j"BoV ~rBC7^/">1*2ܩ/ȫ-)^YRYlw4 \{rۣ={w7^v7.Dbzw]dJ8u f$Y4N[ZPUC.-\_Jʸϱ_\Ki6 Xݤ B(\&DԏĀU37)+3OB0^IkEeOmBxFCrWx ė4.B);,c'%;ep7$_?`zl-RԘiold-75-Ѧu,GY7mgղޒv5FoWVoط乃ގ,;G}p?w/b>tϪU.D ?"kh pQĢ վ, (e٦a񙕑g,D_ņ0\k\!_N"/RȎ2~4Le uYq3^Y*XSf# ~_VMFX,*W|XB]MUQJ?FstP'z47Mm6hB=ćKCbg+!6| =x=?x@{_[/^}Ӣ39B<Unjm26BCQsno𶮱Y@cB DŊd\88i2uܐ55^ aP|vMjz,*mòW~䕕#9{raE` D\j:ȑdt>rTXBݬvI}1])vOeZshÑqlh?2Ȉ&0xAMv3$wBӳ>#[&G/X-wkxS`r , (p9J&1TIcnp+^}EJr~bdިVՒ-F&tF=$kq0( W0MtE>y䅓P'.:kS왝羍wSpjȃCpgjJsڶ鿾 Z#DFױb58īY·"x]`W]{ RʊLN sky@\b̕4,W(][F̶fјT(fXьvzmOpI Zcq(}c|H%f|}xf{pμ}{.蚛.:͇\Yȏ3MwkSX ֓eIR:1vP\ؙ0N10_vYL[?ޢxĀ %iR5.uY卑{l4O,(Ky&$0d/jv׌"iETFY 2!dL(,Kwv/\'1?sޱxHC?vܾo[i?nYGȰ\{2mtW ~1N5ږG'wՒ@['XV8 ~˞"'+ _ ϥ3B ޱFǂiC' ӛN&kaF>Y $ )]JD[d-f1.bN|y\61RXwXtXb. 1֝d,&w쁐,EAJmg'#tݳfN^^O|G׼7lV#oꂛjX̅JoQ<*.턙Z}gƱk8GBz `BZ 6j :jR +#6C8jUi7)RlWظ+!:c},=:%(v\æ>s3凝B´ZcdUJ'䚭)XGDži+"I!3A8l"d(W7̴dHCWO'L(v4fcrɃ@DbvmsVq~{-3|u n9ӿzMld)NfG( 7PZ[/+yjH^f#9 u%/D&"&B]M3?D- F=n8q^_+;=/gVTf!GD#4S([Y(k$i80*5 ܯQ.e)J(Z 6ⰪNh kMK mbWᯍ6fcc-xkؙ%PvwUm]3Vx_>~ECF58ʼnxwQ瞽|%/_o~u[BEyԦzCb4V,Ľ / A5|HZ\Bnn9 Z;oB=? lm< ;g4d['lCrgעAn[ *N5[un%<.{z/1m.ឺf<=NX;HÐTB7W0\& #YEt+-}-{c * eږ>5v+kڧ2mITUZgG",/548%!v@Cy}2׳ϰ/wgq_˿r_>_Pw_yĻ>?c7{xǰ \+T0 աsW/ O^U%a-5ֶf\?gPXh]n'pr ~vi$R 8LՐhGimhqs- F V`󱼱Jj]*K<0Q-@">ΔBĹ6aVgņm 5) gcr} ÖBJ3Ҏ2ؼF2rnSo:Ȏa]QaĦfean yXcz82Ih&ݧڱ|$ԮxI4"=o sRڧ=Q@Hk-ⱴͮF7>$ʡ A|or+C I1{u+oO\Țqrf'  1fm8 4bh/f;u((؃tF+=A# o<.~ZLFu%4pm2.dN9 V5zIP hm\]ѭ ;QJ\F9ʋlc|Zշ-y%$PG8X=ƒoMWcݪv-Sk噵g;X;~=cXc҇Ի+Gzb۽''yۑO?gJMb; k[ma \FePX}y1GqVt q $:%jԋn$iC*SReGDٔZx~h77,$=.EFF ؉*6lALH h] $Chi7Dj,G׬n.kn*=OF\ 9WskMgB1}+ ,W!ƻ*)+/U>MYp Ώ{Jg8ZXN+gۅ2Bo]a@FA^6x_HmX-P',mѰ{yFOׇ#< }C( lˣES hd uͭCV*gea7]#y:AL;Ԃ$  %f>%)z2 0 ,oIW!e/%qi$ZZg|L/k=A,n\@0S麗EG__PH] "wBQUA/Ԫ22rWb)ˆP hؿChˠ Ǵg9>gGYO¿fbY|ٍ ĉq\ fgl%g\WC@?caSeV~i,wkNǓ$}ǘM|`Ge,oC%!(8L[ ǬӅ(TU7Hѕexg\NWNYz:ڌU|h O ظHD|P<躱8HÃNä́ՍLΟ'J!X@lTFm)f5=zF^OQ=ͤZNe K8F%#?$*m(\ɜ%Vz\h9fTzY:L/)P :خ | F1[@X&d-}u)1߲+7'p,p% Xꍺfz+XJYBo`[tӳ aASnJ- m#8ȮX[IEzb"ʙpg/Je%zhtvq&c~74-;yXOĈVՕkm٭Z YmwJyOļ2Q$̳_v_}OV C>M+ ,to*T7[\1+fȯPeA~ٴ5;=:Qʛ"AX1A |k 18wm+atel삎`ٰzq5;e!et \nbidp5W BIgbcC0Er[b:2ET g( x糃q3ّ|PECzWQX,<lc++:uܷƎD J(feLխ5MjycZ+zň "U$( N;LS"'r}YĄv*87&pmS>UJ%Q rGq*\ha9Q-± (!|V#~ 2 P ah|od|_޲vĝ%oG_/|K:r?m%.^%^_~?W,ĕ"]ʓg ٠h."2!#=PX}ZS:ܴ*6ml.b5)|~n0 1+eGśSœߡy;iGFA?T"8EOŚk _ ]RKAZUZX;M2vzak.wZ.8O_/kAIgAv>Ў<{)6"h pUX^qlӔȈ GU$Qj15_-'a k`xhX=b),F44A%p#NNZ* "7DCh>@{]8< &6IӔޝY&hb,ch[F" i?[нƫ7ȋ7-XE Z ȞQ&ޟD+MMBco]ׅO;֔UJWNIcaF6kcGٌ(R893D=<-)7a(mJe3a!RCJs>Tf*2L"Dtއ[Jp* "*b`šuܽS@;uTqVr>Fo.6Y^a3ӡ^LkuNlP ]F@rqNɕDz^:4920Dm謙*&F;3b*7y3mju4G#(-KÂB"%bW ¡cX(Y팬#[~dWVaxnVJ&n:uHx5{坯$>R,NQ !ƺ w#EY5Lϸ0`=A#9 $eC\JGV|zKS8XZ/{:wz7ImVm{gU[԰4Qڋ QhŜ2=A9V&Ec kި \P+n8ssItM].ܸf)GQ͗FB^<*_)='.Bt"J L 랝D<1$qe!MFJTH;:)IGKF=C :d,`r01:T3~fHQ|N%s%V:Vol[p^>ƾL5EyCǨF/zn lm؇zVNƂE2z` b3"$h,۾m(pfz8ά"L7 de]Φʾ4U~\Wxr ?}r# qXSǟ$rkw윺tY܎:laNc3Upi\Ԡ[X鶷31Lc$|cEfǧ.*Uh~f%Ǐ˃mJ vՎ#G?{ $JPK I ]YR@b^ޒ1n]}cq.j%FFr<ۘ$PU[*֖c'x8wܸݕnk|7JȚL k388o=0֪6"5=mSnk 'es#CUZk4&:5{8={>k2V=d'5 :. IvaZV r_켐K_lzxAS=f[B2D`a1[X|\,TGO0oC~\,yRnwIJ?QS + T$I {0̠K] <%26&0#9h)eJr3>ièIRWNB%qbm%kBF2 ;> Ƹ8߭ Uyų_~S㭆y~0.c/?)n77%g$7k?eO>__\ y,t=Ƕw`!v[yFF#;.&9԰ڊY-V$;)w] *4/v7P?kX4:] FZU\j2 v!WFi'N)x_e1=$Х( ePRvxU[NըH 4ّ\K,x d`t 3@&kB!a|ph ˵c} ip` >x_R`Cd+S7pkt!8KxST{*1_zǿ_֥8ѝt#W\'vgÓcE x?G+L~ ~_I7 {a">9ΕJs$~?HanAiQ&lۍ1"9)bP[Jn}F)M}b )yh# h#v:)"Qâk Tqrn2ق\,\Kyʃb$YPۄV|["'4ڕXSt,)m1N2_)g} gc n>mWv-#OE{`"^'xhȳ<=luz![\X]]/0РN; sbba8Dyq]0(lD !Su ~`="v#s7Gžr򐏓 nݛM--l^}Aɻ%u2,H3D[;WceqXhgFjl}fܱ^J]5F sƖR*܋召rBIar<"]j e81²*?lcV;$:cp"sB 8)q`]z~yc?+" L:DSak 413e]˴ o4Ų5$sleq 'JKkGG7*ըwHLC0D^i19qHuGB!-t@$s93k2 c*-ף]P$K+=* d 3OYm'?'nĜ^YqYY9*;ᲃg<谡)fOr˟^bYpV 5[('5,~^p}x"qVɕ#?hwa9Im! wi]uk ȌujA]@tFc(-xp_u[|rZiweEQhY%Qxqi#Ueḡ"Pæ6)lڴۡ^VŲRM,dvΈd=6%2CO}HG򔱸c?`H?&SB$_xcݹ]]}덿\ZD/,?M瀵A nzXVb ˡo>!t.{"FPL͔BXn|."G O0`=)tQ n0K/pL&kn`Ɠ$ժ bp7.{/ٿo{طx.%Sg%מ~귟}{~y pQ|0^x%ŅBZgCD,dM{ vI?X(Xa#?ZThYqfp4C{pRbwb$;P81 N9@ڽ~وN1hM[mfb>bGzyv`2Vy^8.޹aGcN(D6A|}I#pN]4O=C)$@=z.<1l^3؋Sw~A . 8مeEG}g[ FV02 xnEV"ߢ[ #+A4^tV̋ U#B039@)m2ZHO̼r1zـÔisQ7o8 BH-XX=wGr<\_ C#'XZX2=Vd-k+#N>:#2c1vo ^AvTQ`Af izE$tVD?S6@r7WGpIs] b@&|Y5nm^Ǔ(;ؔC:ӝF"U}{FI|pH8E"eF8-SiAB&[NB{8NXe$NR,!t1KaR# 'v;pC І[`8V̲Ӌ?t\ӆg ޶ש45*ZNyUD"$T?C."d%}ϿCwM 7ß6sJ'Lf gLLgŚ24uSP.h@z/hhzfHD+7(꾨jzh6-$CHQe|yR r&űJ\pW C Ou~=9ڝjPO6u.>\P L scϰ]D>b['=O5;2p 2hzFSCj{$1M2,Jh 5H%mKR&Œy+|sٱ=8fT YDp趛-%M X:R÷ #ZZ]JO9SO}ß|Omx`OnLXW0ؕ\[`f*9v h :};]aXE&k&4FTbE<\&u;#[quSbu=ŲyH0 ^vCԁk{=4zX!s)OB0Y/ wcuKDST $~NlG s<($oW P6z6UsT$! Gq @RىBC}9\7I|Ym y7_gx)~yG8Xt~+U+:2SN"zĚw.3K,"t!{<@`նSc`F'w Ypm_1uÉX?%@)uyF]uC4NEQ0FG ݙTI+\ n8I4Ռ3`SP![̐0n%qZ\_g#|\ S* qqfA?Rj8Wu;>מG4) ' \82ḓ.-@$z_?4B hde )ʄq.J IcmdQ Jpk/Uj҃LLԤ#deE` /ؼܕq h6iץoٿ߁V+-EÓfu L#ys^6F`-ts7|_\lnnQQVVlV`#( ۑ0q :Gtr,T(;A#\zX2u)L>8I[THZ* 383e@ @*>H^*oÚ4cJ);֠\_G2b~ F]Sy_z-a2 ;@t2:A) X(`>SdZβ3 \_( ׌48a$-άX(!BPDOrҤ$bi"Bjm) Lc^+*4L>ud%ĮלRrѐ0oTG`dKuF]f՗_H\`VLD8$kݲ )T[ةsdUKJT jR=OE#3[=8m4&I'iZ˪Zˌ 7srIݔֲ͟[Boع2?ynCn`^Pnd4XW"6 r8Dq%8yKrbǂUCUUE#[U(lO=H++{бpqa6LQHI\vu,ڍ\[n9хU"V ^PQXGc!<3݁a؞ʙ7>,vW[kE'lv@*jUŬ&S %=z{Dzط"oiY^(xZwzӍz?+k3p؅Q*`kz7[jL*;A 6X~ڏu3E? GpLܣ-KBEGX-p@e'4rO"Ke{K[Ґ H S-W~rARG,a35uڻ)m߭W? ;n)i5Y3VHf5DY;S\YF<~zJXUFmL0˰DN+X|3~C1d QzncpDǣ?1Rt-։QuӬMBrSۏ"6A:w7Yi5\,Av QdܠDeav'[b |s9@gPa!= g?f/n9,Ry:+~[o1 tQ0^@%|N W<39N euoH*V?6h=8s4`D'LC|rb('麎6HDg=/|DۙZbt1z|Hfƕժ]+|Nh؂Dc B5L'o ߞ'*jy)asD`%J1 ''0Yn_lbT!" 6)11G`L LcJ|azx4>XkXIx kēyqٍ"!q!J)9R"`caҩFN@6tN)d`_JQD46HLj/Ne<xv^@ٕE/5[^ѹhT=7F mN$H?ϰl#أ|#߶av͝u50}}<oYkE 8ʁWp$] Gq/@DKz{8Ɏ\½U7{zNO=5UUXs( $$$@L &l`lx۠SuoϮNt:u|9UhrRQطՎ_O'OwBtiÑ7Y#ue }eYVZoWkO^-_ApB%㖿 t{*0Kfd̖m=4 MM^wLBJ8<\i=#K&1nN˪%7) r v}Dh]•SH] MCKfPQiy1; uÇJ]}X$: aj"| V]p&n):y=y'^qUN̬z=j@!r:4Y ׁ{Uӕ [< ϟ:vZait h00)k6؏3^IZک dTbvA ZGˍ]^bz<{ule5p W:{@AwsqEUd6.n<}>ӌSg0ؘҁ@{x+ӇA`;=*V6CZ1 Pw2Glbݣ;Q>Ȃ }ւSCE}a[9H/5nm (yZ GF8o+%` i~LP ų+7/"Ԓ>챥Tt#X=7kz% A"!g j(%dewO]4:Dp_Bs*!/T: R,(|q|:O6`Ӣbu'俔O^KC+{ OuoO9k:*\tASG,& 0B}./Qjk:g_~{IYNd Lm^J, B c8PNO95\dT+WplO3JbfCHUIm_h۫S 6]~-כ0<|MF90?v Q~nD}\S̆00V"-ifӱ];U)pʯ?[fEٓeTDDTDê@e;vb壀E&Iɢʄ^$m ŏ>GMܿ̈ a+}bu00.4 *c2M",Oic$]odg"kN NV8r9]gрE؂,U$4,T9ٖy8H7-[}ªTG>tZME*@k𕱼G\9u"W2Bbbow5ic*fdAɚzBHx@e']h^10G'InTOq*.KRE=T哆sn ^JՌD֭ϙ=;eK7#?~7SVU{5@+ (LkG7gUŀӕb/ .0;,@FF73a>"emj+Uu rZ5@寙^|q{IC2)Κַ & Qt2tYPz֙I$4-*yD bN ۡ-+_u8SN6l+f35YH>A2d$jhק*8bhfgq͸фEq<*ĪA ހd+V}pzRҸijirs͔`\ 0ÀGs)H/2&S}b <dt[/~yVqHQrC;c7,PDžGVZϩ^,4?]U3L9kO 2}:7L<Sۏ1gvؙtjfj~E 2U~V'AfCLȏy>?,7h D$+6LWYJX*bXi]%4f#*uLOiT .n'3\AnY.cEL=Nt#5߇=zeڮ6L>]Z^`тcEvGɗw wӹ3҄xL|ܯ0NuÕRϝa5 ^L7jTss}) #H*Ԗt(Җph"0 2,[ڲMvt)Vbk%tHW UƩR;kĞc[i}T|ioTDU9DoQq | ösu[! ХlaIEv>+ :%*0Lk#ش[(=\I.'J4CFsaqZxPMEG swCL2% e#9)umN̵ȔC$B+|(]_g\L~|J笹x0ܪŊB/pcް%Xt)8\WkTrM`Ub}7}g:פըLLkx=#^&Aێ_٫xMl(͉.X.Ad<+J;" cP4rT $RI2Wn)+U767jE|?, mGE'>ԙqm w̰]Z22]VNʁ Rb~? ID8VnQ'ƼzQ y}HY6$D6Luby,;2AYJYnG~G/;Ku=;&".6^QbD[+i/PI#sDSAG?ОeIvs&PF~ c*>T\ @ܗBI8McxUeSC2sʿH-U!\$=zV ZIm^^5vX(fiDJA @ T O˸VSWK! KO|uX8h@sh HtqqFdP:oO- D官UVMr>,~\BnG'4>%WY"05VhսP's9yet ɩPXS s߁c}kpB:|H~EŮϑGZisCs{Hݞz}]Nitmp8aou7![3.wUpּ:㖵-C #i&̝ܬDppIF97*kHCu[IdLS0~{>)Ň,*e1A}UQ$ ЃyUlZ:W>CtnJR}:eDb AC@]\yd[5쌘}Vc Ts‡5c+mM$l%㛁 JrSEiHY @:!B0k/P'nt+.)TFԳC+䢟/ >|w `kեhh.wg) &!7X*Q2Cy Z0C갵XpE stUp$Zi( <rɵĆ%JrɩKJ*0;˕%VqL`)<NpA]y|IgmHw@5s :Wed`A+/ YД2VU_mbUK5[(IHSx{r6滬+xVՙL'0yݓ||,D Ȅ~aaLEN/Xi}tMM?G {\Lqb] wUT* -p$>J y'JG˔ 5^2rR֊[i(fkP=Iu6HO"Ky_W59&LIkNs/`Kt=sӷW[qA f1߃C.MM#vAKB>,$;(jiLUͱA҉ S,Z g6UGKï0d=F=v Fv 6K>鄈!,{}0jdH8EtW}kS<в{t"Pgө*s*ʚӟNgӤ#,`'K?{%2?xB-ڞ9Bw\C(0PTMi;蹄NYq1QbU2_Ь"Vw85E]Uz TDBGk"'ltM(cY.`|'fzXǫ;Fɑi]>qJHY3 `fǒ*MƢ%e;:S]bhGKa=Ȥ!P^9g/iФjg<K@-8ܵzCz ( С 23gx DкbQpu&#%Ҵ٦RmM1"eu8s(7,%ZɊX0,p[m1‚ kG u-﫫b#+#|?i/KWܼ<KdX2>9LSH`1SRQ0G l*t]esZ6Y2z3Ic{H:G#jÇ@:*d*:S2qbQT$w#aNPּ'5\$+jZb#/6d'07$g MG+vH#HI̵9Bo.QV3Yb`*x4&ȾIkzxQ *ث=ĕ%.jvkj/r!=v"ISqRB Gx aw=D@ot[$c15ߐ#_'[ɅaϒTd&?"}LF1y既 J@Q <P?2 NWiAKG2)I.nƗpcNۼ/xXsqWRÔf*5Vem[a^U_Hڷ*mMcTCm.1,KF(jUl'C D=O'FIJ&]U*$(iyrnYv-gIX9 H\F.;K%'s_7@870$:A`2'26ɢoAK ʲK9B!d0j=JB~x}0P(1a^jmJSzʫ>umWH6S/2U.w`R?u:n*r dz'/GV)=WOkï5tZId6ĭ̃q)+R3ܿĥp0%TRz<5F^U #̲5ü͜T9 SJK01#gUrRruo!&D63&d{Coϼ33kOh)B:πܡ5:I2۷!B )RQ(AHg4+c 3t`y}ޥ{ˮ?yzqzIݵaF jQP`pԌ^+χ|'TZ)Zڰ0IxYZ#@}[Iu Mz#v!ㅭT _ERK:@!#p"`ZJ+*K,HNzo|Tkk$ ]uDuԄk@ k!} Mo$_~өzod &$UΡxFU-%B9k;X_Gp2J# .q8Lc96(ҖGE7 GLdn"紼o%aJd*f4 SnZJTLRKc;Z- ey:kձ%7t0H+*ոΘ/Md9Búl,WvT:[:Gt6dk;7BZ?D 39V={jl9F]THA,qk̈́bvXk4Tls(ndz J6De*fĨAʟB#4 ,O&a&i`K%n\nY-4tQ K Py?P/x eSD$w+4yxme~ws絝{;מs;;sxޟ^\HDKؾCvwk=CQ:8_γnBr024h6=p*d.I?@>ZBеj#ve p?pJ( Z~e1U*(,/uU4%Y۷mPjR1^^('ea{0HQÊ G <^yat#s d2@Bd#eQR^e0=CAM~W6{23g;7<}@]*1 RT@lE@'}wrH>66!aJ;RsZq9T@R$9iC*D6i8Bnw]F"-?MذQF(`ц+qZ68GNJxh8;O{63a;"݉W@ZB+ ؂[)4Vgܥ9TVkzy'7h8~Sdhv#>J ($n*8]:ӿ=y?cf\LJ:Ҩ؀7ry:8-:Tw}Ϸ?^u/fqG>ܮzHgpDMiHCc MbnN6ݠF`aCgA>U1!w$rh@A3XG0 '&j;86R6;oSW/ERXϜc2A]<;J cvT%OGV¤c&aiXM&n ;PCCdh'oA5od;9R?Nz{]O_=ޑ۶lNv~z :yS E${z^>}qc\RouF׀Ac€$WU0%cuO*(Y0q݁XuR+}ʘoQ}7$[۰}hgL YE;*//%G!8hLVblP?q$^)25S`ktԮMB?AV0%Z P4!J!PoW6JV_(NJ|ځb{*ʈl JLȑ[d=y%UJIV_؍P9s@J6cd.7F\ tS"DRV 8|_nMXj>3s1h%c A4*7# !9Mo|fy5Mא';?k| 5U`33$H ['JP/oDƶ4QH(1anA*aq p{0PR=#l}R{TT<4Pu|t$NF[Ȗ-]u-~AE)el)*?* P +n<92-e[U<E*Ю%C̟"qAxKV)CNDXJ<\3+2 J&D}C[t#B XMÇH[̆[߫~[Y%y||:oc=nl-?c*e:ګop{e~̉ ZV'UW.Zu%64=$pd:ۦd6\q /)Cdz=[ƅeUlp<d^%c< zN&BxNQfA)lJ uLǖ1T!sRWdrtVcp^3 h7ڧ1 ᦇ1 SYȳRRZȫg̳6fIN.8IZeH0 NXu>Q&s!l[<G|u?ˎQ߀>r[۷B`= sl8AtH: .ňl`'Ov{zh&pLWZog``7ŮF:FTT uZP0 ,-iVZEPYU~Plp)0Փe쩠 9VÅΓ{i:d%2۪JPJP$'ؑ#ՠӡt,pEvU lu pta ҨG-Zq$;@"~ EZ~bBWfԹSx&DTbL*gVjR: 0PGa i^Ll (lR lrTWoDԜHu`[oHsau_JsNy)!\AWwy%=8Zk.' 5^RHlM-b阩4 83.,Wؓ@->O*)u@cs6^' -ABj0Pw:(a;I*"r;U_nwD3ƈk\ 0 יTɬ (xmqJ5M !6dl~(KdJeWʔ B=G3T ^ad'ԛ{i֧<4-L^=\N^1UXjaፋ7gi舿P+*hs7FTI`(@QհxbCsᣦ"3MNR߯D*"9S *mxcV*eLB{x -;>Mh,pQ}⹍$@V >凜5;a*5DۂsVęlOzL7;QFI w}hszj&ä,19C.RaZ ;gt֙qg_vᶫm2O9rξ;ɒ/aoEQ]y ֍=,~?Dh&Qlv>SŖr֮I YʞmŲK]VIoNji .ր#0'JWڢVHӵx_Q+eEyud:7L:Wȓp.:{-[o}gg>~zT)H *V֢ y/w)#Grwx?ɴD ȐFY~H|ˁZX(X a)@fOص|Jsw삡sU]^VN죫ڬV!\Մn흷0=/EMq%I#Li, < e8 oVJx/כx]Y oOu<}w=|%A!>;vfy~M\ړ{zA6 BpT">G`΀lhvaOnrJpkߩ sI"F}%4_ѱo_DZ";9O+IAfNܓy)b=etv dqQsuv\+.e5sIeVELi`ǓNUr,9*L}S;O zwݝ'Olؾf_+/vV>xAB$2ГzC/aVyuwcYu)~6udK90|P=66ԛʭSwݝ4*^Ϻ,K=l5fhD@ zL82Y [\|lf~NMC`FIC.|8I݀Uw܀vXkY0fE&ϓ/ozo;O],C&"]61|hW@ 7yi^E"~.>QXåv D? .ܘMxs'H_fN! &H r@Nץ™Pm0M0為(%=Ʀ4 j3}5&LIY W*gk2 L헃 *딣  ]X%T58MF3 2(VBGp*ر̩sDŽ~na$8!/ɂҎکʤf58bQGH v\ kN ̓3oBg]˟}wcH}wzuWW:C/ k7<Ti*:ȫdӎ*d0| Dܩ_ך@W2wntVM8lo*OKպ@́¸@x3ԭB8!?t S },5pY7;BcDX91|Vhw[Tڽ3_8Mzlg .`:؃($7~?Tt+֌vu[CRJNɦMT̐mbRL]4j/x}vujۧ &vCYW \孿Ir$8]}6l<(/.P={$mTl]<7^KhC(pR'R )/e,N71%0Z99Yv#Ԉ!"&^gNh5ЫԆ`~&j/HiEbME.) &Ìɢ_<@CxBx2N}`g^~"7$K~~֍=y] >wn . Ս$Ӛ-fU5k9PEMS]ݨT݆j2^n>W eX +bb2? }+ekĂ46Yz["0F@iZKQ앚wS\"LN4 V2MT߱ 9w&b@XJ!S3K9f2` L[#PBeq[SaD[56<rڂ^L[u q09?Fs2FR)zjr*ʄX*ZHmC:4Z3Cn\aAE2WK!KBV t>DM129_9o$M~->?}|oϼ {NfAe&󘵷ݽ6m>0GC)}?GB?L`4VM5Vwy5}^V$jQ(l8Kl}-!ӑm Ǎm|ަHc3?fTX3g{TH"H,7=<6B/O<[6iW^5`=-x 1_Oc4:KND:$M7 zMF~-Ʉ+ y <ǮUa(4G/qgƇǛu ZT8躰< FTld)S AVcA3iт,Au( A^ :+IcsH@C.s _Rx0|5ƶfdLd^D:ֹ֬m*У́a`)iv*m3K /:Io%xuGJ_9n%]>xZ+;/xEjx\9vy^3/R[Y~8(UWeSf0i}DLWtU5Etxr^,/hn Vٴp',:¯"!^λk8-{]F"?2E31/ =K&Ba#VsH*$pu]j"z1g|YAuzZ>5JRx4$9Z9iIe:|o4bL@j:*YV][vUԒEol2e7Ζa?:N ##cG*@akʣp2YKp,,Hx g3^-Xj͌w? 4ِ:0 }`.&M6ueH1998@'5^c*6l~ױ禑p= >NYO(-KRWo;#1QEy8ہwT l m0Nr:!ϒtu]:%޲qK;Ngw~ Oy٫6Bn'T ; s\p:g/9Pp5jwr \C8{J!o @IE{HAS׏H#qT Aղ`?5\&C P 4,&hP*CUޚdym4)=IeL>wH.wۨuV>Y?bwƦLdnkq&(M3h8 i/ :7nU]AyOyv;:O"G8˭#4R rROZicRjn7E3*N( \EDAXV?N0oiNBL;w,\u H,s!˷HmiTaRIa}Js@G<@F%{U ΨWXDv -Nv )ޚ2x9ܠQKЏ6V@`inz3A'i9X91Wv#AJ:zΒN⮊ &Pr o-1^F7`Ӹs9uVĀRu>Zk{C%g]\|hsD]G?䍛M_;)B#2xEŘ_%:(WPT\z 4o9G$.o1Cb0jw4UuT<53֏,Au,@1赡vع!>Rү@Zq⿔wB~)'c;dJ[Wq~_k.f?$/?? QTՇ{,]ZQM3 Kڇf2'.r/O^ R,d~Ù~;y}uh3A 6 nΡ0' @ D@;ZCBW&AjHPpOu|K1(OeK Q2"7A6 K2-_+Zճ^O1My[%uk19`N+uVj U60 qo׊hq*oUyh蠳Sa]#R9zR 68 UtԌ 5+)8Ճ?m> PE=- Oxky)m0Why>?5~(f|Z:J/YHª /MVU}"u)ةU3='euw]΃GοtSpU=P~Wl&meꅎIw"9%``eDg qd;$WI\;rVLy vx9yLЉv+iߵdUQB"ȞZ)t=2FR.¢jtT3!vpjtg%d9o2hEv<&ЬQw$p)j(|KH_5=@>K|ii%>0>bw`L' tA= y>wJu aZ8ό5 jg$T旆Njzno KI Ŝ&U3uͲt(Q sp T/i9b栔kTsPR)T#Ta 2z6x5KDН&P۾= Obk HٓpU3Uvd[zJ Ffhi'7ǙI;LpZp!NÕKR&o۪sssTWg­;C#cÁjޮAF>W!:>⌀l'q;^G 9ݩ30PQRYSȧWȷ{ _Їz ϸ+? "X.VZ91QjRLkhqL_OK!T&|ccɊEο_WySS2t?_amSZRY(kNq3N;f|t8%!wF`TI:i8JzBS~5mybcL\k (nzH1,OHrݤ 0 %eqhQ:'a-lQlR$°^KHLnpOf`acJ\ Ţn] skP>-: ʍlT9A*ƥ3wN_dOd۩Ud?>ynSeGl< 1nz|M'\~ 3)X^.{4ײߺAaIC%BCpT=Du#Ta^BFa6E};s!֢Ƭ[N⥆бQN JcHs9'SY rL6,p<շsZxZ}TB%%o@j!)@!Xy'XGX]¤욧~?>>|G\p0x5X^2Dq&.o/.RV{9*{htrqfX'2G=ECShsv(jy%8f18v!=}35%.Ai[*F >Nd+s8g,?ԭC`](GUkA/DrXV6lpv8RʊE#;R05Tv&YEy Ӗ#& /PMM^ ]:4B#>|v{ =\'=C`QW NxQ _%BŌ$ nqfjZ *ptp}Y}R|;=n 'liR8"_d˺mm ("bHUAzl)fy_{ȆQ>TR3τyu%7kF.ȁL6Gal0E5y6ڡ1 5AIG?= P %߯F o dyp4I_ WГo '{;>Vm.Z7$ pa?V9Jlz9j5A}q;NC6"϶BTs,ފĺ2|~V=VvG. U}c䎉5"ڀ?F0iO_c$r7y| f/0w坛k#42J!Gx"EԸPsջ)79Uؚ$0{}6q6Ca`VYzA J|eM 7' mt:>l"ѹX h/'#a^ TB;yA^ (ר._T=(A3t#(KK7r>ul(SUk{~Ukݑ2 =3zabean6ߕʂE5'$PlʞZ$U{R 2$Lȅ6N!eS/G#Ի)>ZtS +NXW6A^6cUd7%Yz>}ca=t7s/"POzժDl4 Ԧ,f?NĶs*w,B .QyX;W<$捸A `NR7>ukF23mVG)(1 h^&{Jifb5]zͽ|vcm]™aE .%LK,=SYᚶGzr\qJ7 C䕿"lbr=I7@d{[t=w<,KGowн7{Dֺ^ /iV? [lRR} tGX4a{@ށ33X8An:8/Y,U ` R9žgfVRar^ԓ6;Ur_R>DJh&IJmDZ"h+n#]lpl"5f9R#ݑ,VJoS2LꞫ"[zyߓ_~qm.i{af׌y>Xhě>-Ћ}V)ͨ+'Hݕ_ȓx7?~(Dޫe!o4v u@W4AayyB F22CO}S㨚 hS7׮aP\z~ҶR>Ay"6,&o̳qE|鈩 G3AivQAi07_cs(w}y*E,׼x2њ rPzit̞:*Mel $ L,脮ًЦ9,M^z@et["&RO= dC5[ #iL@, ǵZpº@/& j$yXjZ9'Hែ5hZ\:TqR$vjB@oЂ'KuȹuLL dJ,ڤ> _3 ɿysQ+>ŏo^?ʗڋ,A~zǿ=oNV|g;"] 7jPjBtVD}̩}NN3UAϟӯO5OtZZC0ZxHoXY dW0C1$fA8;ߤr3-vF{jd}2=8JL5ۏRO ?\8tS;wr螠IHI3(H I#@12A"٘,dbclﰏwX[U9ݧX? };S_[UoU'V4fl5șDhENT$Ux!;* >jjc]+7wF:hT ( v"z* UkPϑDxܦ*!|o^ &٪cx+nK@-^aǞeh7Z8JxMDe"De%@x7*KFxh&Nne׹k-bikVeջ zTxYZDFmh`ɘm8m9?q*xQh Hx!tsPv%Vk'u5MҶNQ-8+XSGnIreFca(I bX=l] JE~[j.Lÿ(v#̯`K[="V# HJQsmsciT&j"%abwtkjbIfI8A>n왗-Y0I⸹~rLǯVrFؚفYvtqyApAmCҜ` uGq-_,ps3zX8{&[w}1GrKC:.I',u%JgoUs&pZDGb0|Fb N5'!+PNh2Up 4FW;u*©PlxI1WF(62a~Ͱ { {3=)Y^gU l±_V8~#nqNꍽai'Q"5' F`NNU\'X3V^)SM% iKb D8Šu)է?$B:7ͮsU'.d*ޜY9ٝnіop"ҫ$ں(E/9a)܍je!* #ۖyW!?)M(<wx^H>^ERܫVD I!\^`x{@gk\%,aNz6yHEZgyak}%k>1&YaviBV!;jƖͩQ$NJ6;H|\nNէ<6i "-B\5MۂWN>lCTpo*|߂6;HbL(jQ 5 F" ub:%FLɆlX3.-nΦ{hDp8"i i[ Tw1aN_\O;qylp:erz{VA!+Sϥ,OюѹU^ےSrOY2敽 O!]`85IT6`a"eTzm~#6I4N{RDcX.j%ҲG.&0|;_&|T=𣥸!f" ϣ1pazaczPjw_%wa Ѣ^ 8S8#J7 &M,"Ky]7=!67vO.PBIc2*~?'g Nh9<{n:ܼy%x)*?S]^`3{) ^ dZhsγG?Q+\+9ܵ~,T' :Bjr5)-,T%qc6}77IPSn'@fa~ BZ Tw Rku+dPx #8 {T' 1>xeVqA޳u|=Ǖ"4c̸ t]{d;#HP- +WH% _c?m Yy%dcSkۑf~dK&21RJ-G TY9tPE?ɣZ8 lCop񽠒C=*a;gnx)Vr-Hm&!{J( Wݏ\1pxvCpBZ:ѵGnU& ۥ@.9`4lb:E$/M.SՀsR:F9dBmِD_h Qwq*Rk~hs_g0؋06w۩ĞϏIa;uƨP$bePBo yKA-E3EYXѻMmg<y'F4p!‘,q_aH_$ EK@$$BP||ҩB?. ~T:r'Y)(ފKq(R9} e.` W^Wv h ](+PqGܠ^QӉFpjkP -,c;V?M}i.1,yMQpΨV -ԧ @/6 /`).sѐ'¥K58#Q$u1nJW i`KiSU8!<7xXy } U6TQSI;>ׄ?$uAx&k"A_쮶ϖUWvţb9b4|Dl 8~ $D-F,=xjPg GWĺu=yP}zBo)w(] Wh,Fz<=(id_rל4xh [Cɼ[H̃D̫u0pT({E#:6"z8Oeo+Mc)A9*>#hb11YI;UY v`qy"xۋw>F!}ܞ׮H##։wEIp4 5rQ=C)ҏ!{e^}˥LW]f.mxga ik)ݼt(ƫ\! QjUD:w1Iغɥ%6ZHܶdc͸jkEЉwhk!] #PEfɳ0ZQkkڧ.CEGY 鈻go -j،ks-ךa6纥rO/VC2 Jnw |A q%f7g aSC;;'z37tnۖi\m0fldϡ@`Εĝ5ͧ{8s7Ir 53?pM*&D?E|"f6H n`*^Sp/maA 0(fOETa @$ߓTP_/,74Zn?EA2$-b-^^!v.es]QK>j6E^[x+! ;}Y&>wįd 83 ͯg }0*]oPl\6gy"M٨ݐcA=G(JtڅYJ|-\KV%D&#}sMUFyɧ6:.+|K#=e.;!r7nchOQiJZV*⑲nOI` 0}*H-J.ΒtJ;oyk!qj:*Y"Bxm,Kadf֐dOg.M>^,.3ą2AW­H}Lk/wt5j3zo:~==7\OZ8n fnyp0VsZ>afNu}VNNdzCdTH 6zykiq { wukkFϱm$o%V*+ިࡂklme^eE᫞+b`S? "z:k쀪EYi`6-kcRF*\$XItͪcH18dT.I) VNi@緡.CmL"[/q i.߱Avj_2߹Z7w/⯾o{ GFsoy_1XtyzBJ+nrNS"ږ 7-mgb./Zs$W,霦YSy%!,# ў)SCjv+>J;,gJb*a7 BleJEYThq#{{6Du&tmm=oZ,&';rr+S%]!;jwW^%$8 B-{ ߜ= cDf ߗ2򽬣 1{9~\\3<5  -5uU$){}=ƾX 9e .G]EAe3#|PhS?G$GũDkPˆ̪QsѪ'潩FBdqeu`V]=YDUZ/ogo (Vb4|\CeQJ]#*pp7k#LlzK } ՘UFsxSQ[ewCΏt*бy6z)\v&ٚXjL[?șÉG{QvVͫvp 穡#2`\,N+B!% 7"j)Y?dˇ_tKuk'׾K뱯=ឨ0JAZB0YKs;PJ CɵuR a9ki Gޚ3_K_d$E-8?C{p'| ޕ#a|`Fc$cc(xY]J1`g8Deռ1jaD2~r{ XA&K,1`Ϩ,͚M+ %rʱ"&H `Ӓ'Y޸d"4 D,996g<"ŐBza`׋&r  i H 읳lvy^ ?Yc"*}&kc'AN(4~Fέ'~5ڗPtH8gԮ3^}z3&Z+%>ruC;Lz BюuV:Y(qdM\#S՚68/ q|X$ ZJY?vn&V6TkQJ3^ZkFV&ba5ݢnb7FY; nT2ȋӋ*2xP:5Imw62G 1bKH>?Y?yd#Gz~y>k+5zMC?z.B^TS/_Mӳkzy=~OeiX/~Q~#5 =Y:w8_Riz;6e Pp){/2gsx !/FNaP&d:]oF#L,Ϧ^.gx (HЀ${"p< .@őC[5b'Ӎ-Ci)Ӑ'z okWNBݚT8kr`*Z2 b8M~t` ]HGgjBm%Uz:\"$Pbe# gX]{tFTO goFCȏY}]@A5d~̮`/Vm'D:Z#/)J6J,4]QlF}W|4oC$~FcLfݏ ZpP7:-W?m- ևmfȄ L8 aS؊r ݥzI3Xo':+':=x?z8ý4^Ξ+fgeT\0$"agL.ftfR6} i6=.Eכ*o_ _m@: #yL=;mM5W(= t^.z5m`X9=_k\nT éZFdU*iŗ+PZd8rtjN K&NɵtPb<<<"(̆PoSkƭ]pjf3I6LTAf(TRϴbi<;ΰ;sk؛7}IK`wM}mg7ֻ-[쑞5l|(-taRF,֛WiLU>>ʩxmE5r8Zvg;eHے/r;uB: RI⹎5^n{AuPzm8ԩrѴ`;]w}.["GQ,dͩb'r*NGw: QGea$T|c`&'khvW8 *Ѻf.Z`ZPUচlBdx*D~7j#!; >rVXKwvozu^zb{Od*w@6_]n;9`s+mK?;J\YvфtOȶpD] 1).7&׻ c@o3QZa{ VĎxQ`8U!0 6gGStV %#W$x-ut\_ԃu r5݊Eڍm'2},6S4ixg/Mvta6P]S3̒ *_쫤5эӡ89<~*! 39Fi3,)Ftm`/CC)z~b0%Kw n#t PTS!d;UWC㠿L4 /`^[l,*N~R.גW8PDo9a'@Czτ_tfTp6$ʨ%k;NC}Ю/s!E43b [CRm0^ꁊŤQiѮ׉u 7B#O0V\{ M,-T_!-Hy?#m]F^ #g|w-|ޕWeo>.ECէ!Xi֕gˍV9E)j I/d=bgmY$2wԙ+Z܈ 'o3G A>wr;!z$)iA#Y<9P:42ԧz@=Lr+Y<%ҏOU KO8XrUnE%-@L!c3}wMnx+ipUHԜ::QcE q4LB 9/ߓhZЊ ǁp{ zף)La3v+Z"zOlJ+& yZGv*>$ҿ7ii&4߃h-EvSο}s\>z>קwOGg~K^xn-+9fHV<2+X3-vZ_pzI(蕨<zW%'0equAN#*LKqwʥ($PrS-ejZRz`*X/ƀ\F#'4ʹyțGfm#bTcz*:C*V1qzn=Iz  Ѓ^bEy5kW{ru5⡹ ݿ:ޘy[^?YVX% %`\(g`{\K_|(Ep?KkM8h?!dcDQ P밸azj5#7"YܾV^ℛ;/~VQl- m!אֲw eTF+m؄|*(,wyMd<w[V!O;$&f CV"LTF,y{ IKy-0:, Pg9}IgHA 9p38peǤn Izl3Q 2 =marnbi3=5-CycѩuNFM6,bզ j C(C›7m5L݂ޒ7\t~pBSm$ʹ\!K°QoABg$R`m|:8P[u'8Flݙ9*at?OI[prO]zYUpl<^͙ga rѮ 㷿Fs2;r鯼W{^\c,^ɓ ^\ט;4ѽ9MIJ-E26o+l:8BcւDO@Mˠ7IcpI.IyeV:Ɲc ;!v=bJNqmmv2ʱ#K3B/J2f~ Uy` r"zZl7ӎǾlC1|b -;&=H ]VWDEc QOU=j1w_e[ŞކAj( -*^e}gSvC"3fݡݟvi$S_g+N?^9AW6J݈r<{׃$ZЇkv-ފ:ϕ!;b)'AxkL(tsM¥'`C6 ٸ3_n[לv ,t-#%ۖ:`biЮ'W1N}&5`}R<"\`;qF-`XjyԢ7D ܥw͞)^G;Q$Dam^HzTIC[cvevq|s}U_z /mjՏ<64oV6;(D ZrTZˎEV9|t}YC3ղfJ;h1ZxgAo.Zeʶ,@ʶa~+ɆyTeMF(ʇ;?qqaQedY߲jnƪqлTo7"jɚIX#vM/kr*=zut%ngvӇ5*ep&)RB䫸-,6Uʞ_ZA5 [>cBm"'Ebq ϔ!E3§?b=:[Ky?;쏯O~ӟl5糌TuުJu)#͘Ofowt{Cd̵3R#MFL\{U ( ?b3/%S[@By]ENCSrk37pBlFN't7M hc j=>; O >$?PǾ|)}#%wss0-׳ 窅F[&`r&1>9Z?IS9{0 +?W[m_qԱ/{?|Goůwo|8o|#߾KB|9]{\W%O[6b%S?T2Xc&7 Qiv} :&ikl VȌ3>#!\1$<[a2T,ӨoW] "vrqh3g=!BP5QcƘ M%g옼vTD\Š K&VMap2c?R3䧤ONLdW l2\|OC;*=8nU<`T=GYRYR0p x]fs:jv&-ag_|.~2r΍>+i9(cn@CCI'Xfp)YhV=LP\/Eȉ U7+Ml@D^Y6x) FElFhQJE;-Pn r݊qfLª \{6Tڦ1JǏKFXQl«ŝ=l9CC/؉8,(D)Ap!S#؃n%,ہl jMxobyp(OǤQ;pX: Nj(zLB>iMJNX3c?dO`CG:QBhc-ђz܋*i|pD#^Yc(ps|sz#z/>Qݳ)+v3T?mnZG5*jJ5um (u ;s,\L`UMCKt{2Y쏰C|ܩ76uo͟NY\VR4˯l֘OAhJX|~n}r-;фgVʇ0xyҖ$)k 6 MѢD ,h\0&Z 1NvԻpdfJkb܆AY-(N;Nմ'u*,r pHxd-pmG+PmcUD~ fzMʻ.{Mp4H pxz oDSDۦ8)X̙Z0[7 pHOZ\ﲧۈ8T-3{f&o?;6=q7Z4cEGș9:ZZQ(f{!gXjUϏӕP6C"AR Vuy4`A4|"υCS*1͒m75 <yFGP4|*j^*E~QZ3׌ĸYłͰ6 _QO}g7l.?T -I Kuqfm"$G?̃SP8B8b"5,pJ6CP'šx2aࡱm׃,#{jUHn\ `qBzY6&۩~bD%apTpuN:L?lgQ~4PU8~Q/O*~O_Oz2shh޲ #:"W=V4(mvT%48K`J 羵0z/W_ۍYFia5:`F* gEŞjFXЭz%kLA~к~4KZK3.IMj8ڳ,@,ڨ@yƦEh SSx%U,7d?xT56 -W "m􃺙曜V,ҪR&NecdhSTA&.Qlv2A$mOFjIgd90S!4VNVb`Cg_Y^6~䛇CjG5bU(#:ﺖJ%Y0[3VQUg-7tT/r\u|q.ɠp#,#?<0< ÒX ƎCo*u`n}7?ߏ{5|."֡UpRA@ (\@ـO&6d8Ө:JzUX<[O`G Eut&0.9Rv4-;ɧiCt^C,mI%^;a*sS BM[%Z)R+re)$uG$l"{pd4&% }F-6d&c ȩmg=9s47k&*QKT32͢1= \Lǟ-?#Va4* N|M30g$RMLtոS4uo%1}qyD%E]ySb脎%2.|x&N6ud hd*#ÎAfkٰ B AF\4DY3F(%ݺWI<$EӸeK1f|~m_g &xNdkщ+M*cElN2m$)Xnkh', =u?,$ ְ!ok݅D>b&~6وtsaJ-TaU_bўm!#Ic9!D,ݬU )TVOY xKX>qGUB? KV1 m~gSM U9pe4뵊R"LPT]Ƌv,lnĚ>pbAՈ[z( ´˺u8rڭ , ?)85/u{7ӿvgl<%j3y~4^/&3wOõ'x؞!qJ*dle>~O<_ž`/ºSqPܾWu~ʩ ENcyJ@Fe*CGEA~s[#'nBE@|(>p,\k~5:\dVAwgi(md~)>F q_,Bg`L۹k  >%*N(P7Qd87l"b%,17sЛN 0(@N lrGW)Mcdf~P_wpV5ǯ; ΀{`+]O T.5xd۝z3<b?.“l+,I=ލ0'H-xAFy2ڙ?J ΞKwTĒDswHwd VN,j%>TёS07b{P.J&ȯ,r+}ۛK/] SwQ @]YU%*H탬QHZ-$8ƉOaۛqopPe 3Zx~pm6N4I s[/ь6 y&O~{%_;~#{N}cR[cz3|ϪT/ܽO>e;"n)3jyziR}`s6",Ȗ?UTSULUF_[|~+1O=:6fϧSw&ɟ{EWwԲƮ 7S%Mx o*n-2:otliQ"nf>AePtsR pviڬX().E58 ;L}c `f'ȒDaEF{IݿT!/6bԞ;կĦuO.5*L榅LDž?Dsb6(Q.l|o_58my9TL3{Xw^~VigP+z`ƩS,tb1O>,dS9dK:{L>PH[9!aH+Y"GB^kU7`m*Eknٶ*C7|U8Uܵ2I؄8ǤEA k} /aod$5n~ʫ_&G~ayuyGJ/suˎ =/.&w+ip8B]y|Ie/irm)ep='8I(XѴY|;j"jl1Z,%WNf~s˥͢㑓f 6;oXNӢhFtco2c{ۆU/e/4ѥD&_N#u\gp Aj9ŐbmoYœn>a0eݟ {Z3 :̉)G!M6kf(7U*齴xZvMypj ; _N!jgIYwos|5 ˷۾}!U ",~JGgB*E,n=1*[?qݯ\McH$cmm|w؆7#Vt;fVh{c\ãSZU[f#:,bn|4 Gɩ 8 r]c >>uV3[Eu8e2"#Q!,EINyI1o킡AJhZ@gʾd= {Y6NI[.t,Zr + CU}[w>F>?$|+6-lE W Gub0 "R$^Qw|jl#\WPN6!c/QKº.+[6*BX=9\!]2tA z[dX4V ذw^7-([`֬8wI>y٧E9" cGQ$WF[\#5>i77_bC`[^1 ;/7JJ{.|<~a#_k_t >[lZwD-b,DͯʭmmfZ2\i!$Qx0iFB|drp L|n;լCa.ACz#HIY !qj1"Ţ5јrR-KkQX t'z.2OӜ l ]-,"ܫնPBqgHrBj8JU: MOﱝـ?c_G@uMG$ov3O=WcsdvOT]76{VY>띣/MEGȍ!Vz%ީr[UAi3!MU?h,-^W"[ xC^*s@))'-}ԩv(nV}N8TYUa6KzRπbVj85hz7F:MI=. t1 _4\L La %J8lcrV e\I2i1pKŀ ػGi4vѿYdlCs&q V uc8=y13HЃD"@ `Τ$朓DRbPd+PE˲%+X%Y,9%>w,?9Z~,nݪS'+X_@}}}}+~k/zw ?y "J%vFF^hKc&2OO, 0c(_-_}H򍧡6Ҫ hlNr2ƇIYG?|Y*K9lCU2Hy`#QB"KVzOb"|D=o8d(c׭`+bK\#nV╭b5Kh%:U ˲|Ydyiqe$N"\!8 LZ$"`ZT5{.DtӀ.gėX/דUIWI dALq^?d{.{7H`'Tyw>'}e4_}olj5wc1*~ JO;fj*׍`~WO^|ǁ@'-cux[0#F32F'[b%jF/3&,T~[С\YQ-e8j\wWId/ms\r˶8S~|#YohN~w7'OoE]U!b8+\:V10ٟHDw5=ϩjX]7;۶%v] O{R1I쟱+aTT-RB UZC@ x_-T p pC k.K7VIb)M Bˡ LSs}.M!T.%AU>a31|>æ z^׉y?,)V"H&-&QY}UJĹtSaf\Ty$\A%L|Yơ@{t3 RҒ{*9|Z)SFJP?"<)atXGm節J,H/8mGq'?s/>%^zw~agRJ.SkcرK{"j"W_ < q34R9] Vcb*M)U<]WZ%=Ƙ*SzF! |(ZD5y< w{#}8RGF?Ej T; @#0QhnbE7@M4\Lx8 r:mlkBB;W"}q16  !!DD#%LTOf,{+w J0E8YE?y8/ |)a["-?~?9)'4zԋ*Uw?<Ȱ%? )ars>"X=q+Yq_u(nl J>U:0;M̫aqswk<- uIgƋl2UFk9ʗMTHy/,۶m3Ok}Nj}x8w^-޻{K#o>>O<^k}ѻ޿XpMmfQe^_R qzP?,S HmBP|^HA [g6, օɣd*>yDG9OR{4ʅrcND8Y|zxJ2Jԯ[Y:༶J Jp6/<+<*f^!/Vem̓%̕xL"^!,į<]e}O)Vt@6W+7[k̈0- k2_Dmf:` v$F/A.[xs/}lk: |kG^{~w_[맖OLaܴ c-z^4vW};i)_+˴k6R! {LMd4wQEd464*#F5]5=+1UNir2Ě2rC,5uבኂcCghl2@k2=TCkR\ZɖTr``5`ʉ17rR.dydxC2_#<CgvI'P]*%Qka0e~+ 6'KEDe֖4,̳1v)[Iژl)Pȭصb=bʶU^+Q2յwT3V{c8..S|MEidL sK)>}v3btA:2b, dv*ᅬ/(ӖL`՘n4vMBfwa"؄Nv>~`TڊgD8zd\ZP]D<{ SKQqʭu~3 jbY@&U/XtO$}}|ԏ[h;z州쳿|7w3wzYR[J&` ҴqQ8괥(v4 QO!}FgFDmc5zm@=b)>;n4`tŭVH5"}˶;VRPUb!-.6;/K`jzػI3d|5V-cr<Y r1;5{uhMHb5 RM,x=lD`529N[:wR3q WCӽ'=nL h`R5f0g.UHe!O1bАPKBѫ]wbJGYyDd s6'TyJņB27LD.Bo ]W߀R`|Df6 OsfϜ K'+CqWW'ewy3S׀a˾dɔ) eelt66*ID7{Mr/ [؆wl+ۺ ~f[F0![&ȎGC't)+e/p]D5+ _u:+K{&XƖfI3 8n{Yg{FylG:-ˮ_=rO$|kn|澫,>NfO\_^ڈRM/2UQZT]/\U2Fzm1z2D oC[LTt(vl=l'J"of[bN;LEZ6= N/G6iy3_q$ޢnN\sh<<DL䨎PUne沎ZqZld S2R }`_a_G/}uPkwn|}㧂sYZ_ܧ+PC^0~ flhl"DieIX$~eFd7O$(TߟXXUISkEK1L[lD@YBo; capw[odc{US aQ* /y= Mf%YZBM\d>\ጰa>y oxW9c#FFQͤЙ^f:ܬo+ g1Xǥ܈H3Dޫw"j=JUCaTίGn} VtP=:Fh]ֻM {QijwT T*—.C6sgChLV3>QwǣUL!J?p{lwXIHpܦGT΂TMʅSH0ƒ$ 6h1Yp bf`?fɥ\v.-oQ]jePV*JF[>`F :;CmKx<{Ǩ4-=JdN @cd/[v |-Z|k"@nLj)ܕZ ykLJu*y)@L6&÷59w8 ȄA3a{TL@mKpYssbSuZU]L|/"Xasdul#Y.qHuٌCMY xExn9`9 6ɮݞ` r_ϋ`zNy*]MU-EI)¼$ s\kV^C2q <|  8am|Ok$t{5ՏޫWF塃CifKdرR4w}ߢY6xȖݗ}W3ZG("r ~'&aZ'UGD2MOCO`c\/#FhiDB Ez,zȡy1L7y輷i3*ҖOJh!f @./|QBft&yII%xnyDq i46z}hgX>wց|n?r#_XZEh!8FjU_wI㮤}#:VZV]3]Z ZW?}aO`G U }h=lle xbw lq2 - =BƱvʓ񉅚e'D0 g0V0[ò/ w'œPI*+& R7a6h5\쌬%U1ݚD^]o"ɔ*$>J #OIPH(Q}z#wy{7L+ZܻͻN{Ï{CϷ[tWWޮr&Yf|N^:(@Ǯ ɍ3v2?ElS2/i人DfU(zaj qކXd 0zm!rIhEES|pVl)o*сCE8$I+[p`9; gfG84]rTkenQ_*3NeNaۅJo&7mhE*N6'rI) )b| F)HYV?cvm9|>'7x슨e^,fAzJc{PzZFXȃj"UDi/ـ nK-8sbʈx$ȝ6I޶mh9*3<++<ʩ"L"'fk9-,(Cs ZS.rVCRX+ ;fpS'Ww|Dtj/);|-%MDќ#2'8jwQi`jih%^bchJ zVTƓ+Y'$1rG H'PZ~{&וVPAy#@ ,&)+r耰,YR ~ڗ$a ۗ/)@R!Ƞ^C ;},*fڐU<$}]DQcJh֧˦aғZiJ*&E9N\rF]Reg̔ג|rr~0,HʐN)4Exl=s,䖗YjɋK%id" /"ZuE( ȀX'P-PV>u9X^q@[CZ:Q4QJi+spk^vӘQxl6.{f[j5-glm)-*|}rA4-%l&Bs&Q]~OfzB[u`FE:Dz Uej\}9;*0Ps]c à\t#1_y=p^s]8.դhŰmПےRmR"pUʛ7n8,CJ=3^ _tn"~:D*Ipd}eŠ[(L_3+ugW`˜YS_9aL ®I%E_.NW;d mc:}a]{4ѩ:ՅA|o$T |KXe5gmCC,2q\0)'q2eq PaCg@ST$XcRy~p+ [%/EGO$U, 7ZT%$<]|(3\P4Ƣ N_؋Ex0d9exew:ؗ!??]q6`=Iܰ[Ee.8]7xqLB`cQt/@'ʵзmmղX׎/)u1(|Xj̈'[ɰnpՎ p1FcY/kg2h1VHK&[e+KG`󺊣9:XK0[4sxIzr)-Ze N]'X ¯/.Mpmf1T@i3 `,~w!=jWW !.7‚∝qi<&R06B-WOJ {Wy%ICfRUS9jɕٱb:n# ~$ ݕ5 ,,Ia|B Zͱ&PYc?geO΃>^/xG( }x}/e*7kz)l-T- H)K</:3s4F,`\856r`Ȋhʚ0ӂ}ղθSce3<UMO쌽L<MFijXP|E:*G*\ 8+JCc-I/1ʄ}{+, FgMF T-_ Ъg[hN)QJ6OIpH9j<2QM`wTEeHw8M+[m8gwXMd+DN-ғ,Qe3 E|IPw#ʙe$x{^;2jiA]A/ I}VRIR~ =PڶLDje||dIjE_^T=IAPt$Uԃ\Sq_U}UjN-Ϩ齵.ݨ=3C g3<{t}H DYX_)(StsU#i%Wܰ|!vzv |ֶ7~s/Sg^?ۇu*Ȟ{^OF,#{D*TNzrP&ؼ}-cvuq# 7bo,ᓪw2JcNTzQŒ(`QHXH+G11K ZTB +uU,*>\*Ic`o?(6:уV`v\L+VQ7ǯJJ TYFGPLs5XZyQ #d1Tw6w!Gd"@g ɝB-@8,|t~\9Ql8&:NTMQIǔqR*rMv{{?(l+^|wƷW}&t6U'O8oUB"tb(r(?-AE _ôo 5]ł<:d1WJI>9+ATW'ϝ$&!2 v8U]b,,o=ɓS6b`" WB:8s:v{[:X, ]uU:Y&piDc{ cl킭Fkw%3>U' a9r B-"y^{eq})YPK4g_&c>\j鮇ن`XNiH)Lߧw3~e$Iwr$KvQ Cve% +yrZj{LRs*,f5 Pk݆n!(g2T-^邛0p:Ahsy{@X B$dap>"~fG|% }? п?ع=>>a]:m9K ,kWaBIxـߗ*_'Y'MBP 0e=3a%Y1I3W9'`fLLi cŜj. 0˪dohv$Fd!XO$bȬQɦh@N\y% Գ4XUHzf m3y̞CО ^PubB.iX'MdYTYQKCN1COa;A.y[x7] eW3>X)Boݫ]%26^>,DP#ZwhO*TZLr 2R?iXソM5qLY\ѶKI"T9 "I>^PD&E5LceE-&KwOa p'"*gO؅ +iIb֑^^[RnQ 6f U#+,Pɹqb( ĹңBj(-enyA^QWw&;t~/Sjlh}rB*i_ ;;vI:NȮhıHl;c2k3umj|W cERv$ɇ%I'a(l5S DOr/TQ^&: ߨVWkI]WEtVq0*D37E\Wȋٮ:%;+x_*V>3rs.!r՛Ո(7_@x4SH:ƈeWhe/"r-W`LlQ<2:Kּ=~$?eK=tá+]9gnZ j~E5̵,Xרjcݮ5϶q$k􇚋$PMM®èڊkj{"H2< Q B)1ȊHPtH4F :b Ο Lxۙ ,@,*y#xowE`L*h$3ebЯD.V}(1OS 69 W+ʏ; VQ 땓LYD-'JdGu}hn sW˱:*ۥZOLb9+ ejs$f-cqI7\–9>S!tCy.RznM`6M,”: gV!k6?UIb: J}Tu*+Ai˾lt|Mph LV9vvSeegIDA xbً 8' ,*1]uqkЊ gY'M(66RPpr(s|qhTڿsLC;+)+j}b7{Vc+G Lu<a^޴?Vr|D};@Qi<[mn??tнC[/Xoݙu䁛oG~'] /ؾ7rB틃1jS;]b>m: r &CNr\w8B[`ɌsU;< `AXa-ykD{f97•;1iޙ0wjb6, cJ(/]F{; eQqEex6BN&7AIDn \Fx#p |mw jZ'r1H!}}> <-?+κ3Vo_3ca/{I+[Qbhٞ%,<3;(KcT1=@HIR55 / CĹq%I`T\%C7EmRzPŢLk/7;ZOa,0ኑa` r`RP&`~kЍr \? 2}#"_3@B&ImFeé6+$gb2 :f!Uz<)bNW|^JdtGѯk7 Yy IUdLPJ7lzpU@i_݀?eȍ>rSnmmz <N[mYw;oM[,[ڵmN}ckUӅ{{g5]B^'_"y9|o|X Kl^l}-:'F`"RJݽd.HE$v *x52鋤(7IIr5J?'TG)AhfG4i^]eVY_SjKPu{r5׃5V(T`|oH qbX`X|ӑ+O_}z7>y7{bVSA]˼0j; n(t׬o"–TW\,!Rb:&Q!/BJҾlE,\[J|$'UV*fsTq<3PZ PY`ؾ=p~X Ԉ.G2|MS%5DsDw UR47dA! G|msɍ|Ft ٞk A*S$-l[&)85[dc>EC-I*N763箫lyv eBH Y Rp($'+[c&1dȖre 7ŅRRX 8uZ?YO[kGݏp gK?t/%yulm;6H]e\ӻK Xn#R,mE ezziW="zwz\m5Օa=r w; JhKCQ_|er5slF5~j<߀ֆhn n_T A-Mjhxgm2>ɉŴkW5`F1/RȬdS 28m׫,$Ѻtr;G ZeZh7:(S B]6%"FPM/Æ'$"AjF|Ȳe%|IJh M kS(8¯R.HUnjE逍C @V; AnfO,p+޲5ݪYک>0Xt'L E }Qw{[9w_zRD1Rr8tT$VĜ+vC զ@;9 ' 0 I 2L 0gmaK=}/[m'Jp,Y's~{S+BY-6Jp-ʎk`$~=peh/Wuf(_Xt=;/Rġ0녨dA8׀XX+Ym;6;V_5 TJZcԻtjaoww{ $6Sr'JV1euC/dEcA ME[ *dBkQD{D6ͻ\f=guTvK"ĜUTuJ&a Yt yIl%a tgU d)ganO\_L]CrYqd΀`ɔDUXRG Dx|N&NA &}>WklqJ"! :]/+P!?N`wv ty0Ynp61L͢Ёn5ddFp*Ŋ]]g=F1+\JIG*n0 USyLC2XZGLsǧwӶFǵaML_K`rѩ.Iɚh5#P9Ot{L}/!( r&g0"Jr l]WAS~ZpY6.v>ª;3p߰ބM;7xS9hnE/y]՟#c$se=&(U:p+@HvaBp0ZpTJ w|IơL]ޮ# cW )\REeccSE29ys!a~,m˳xnјlWyoa`e {9PN["84[v+`%U=K >?ЫaܴIiгa2]X$PkPu*")`D;ĩ!CP)ǽ?kѲcWVVH H-,aeQո9JiIܩ9dW\E<Ǘ`>̾eL[@DpFh`s2UL1{}S}@|H$: KLpkH"%9rP@sy9WAܤPrƆBf \jkI^w\qt@Ӽu!gV[ n= GpɌQLȑkK\RHMy ;.doaFNt7M,84qąrqis8r1|ylb3J줼ܟ*_dNT{RLܻwXjW80!u+?Nv8[WzD57`vnbGrh'>I D#gH%=q ,5erS)*M)Wa}Q4ۍqgo1%{a cxQ=ͳl\26qH6^T֏L\$vG$Nh\ys#{+>DO%,蝕a|erjcFֈ!Dլ+ s6Tn"_ck M4/h8z_ٯjcdeE ǵ_txg螋ַzd|C-RaOZ0~zaj o&@yL)ǩn)Fx}?D7Ǒ2|j[a&w*A6? Ei \< -QFXͦ]zJIa69U QKP`1"bMeyzG0u`QOĸ>D-/E(W2^Z S]mg!FC=[7'cmdn"^aW%+w: JGv%& xD,HWǫ0T^X GzFeLR$XuH*C9\*&ۜr*#i,F"RPuP|m6tHu0Sc/"NZk`ʂ+;(J5b`d1b%EaDr^&&l jQʩ# :ևoB*zm]g: çWbE xM sGEQiQGyE_Re7/;-6s|o~{-7=n_ozο?$qυЪVE ^q_~i7$!l0vx 6m+$X(>n_ ש8ѝ.Hȳ|_ͲaEHe\ʮbW]?̳s3=փtsqˇ\g|[z $I;:A+B`wV6b,H+_6T.qc>ʛ7ܝ]w ^tz՗z{z;~E^OTldήEN7Ca/GY_Q(4YDtHuەyV xՇQ0h~ Gx+} a\PlYϥT*ST7lĀ>#VNWar^cܜ㏠](9)_ba P\F?DG,H!+'-4X\RJe\o3|͎'@Ⱈ]0>8h9O<Iڥ=h'm2X(*\a)(NLEXC -@b•T[0K:̢:XP GT󗮍CE sP8Irc 茹k1"֔uDbN_UHā3Uvtq1\ף$ڎ3&\/]aÖ Cπ|y aqs?(;n2@bk(Rۨ/чbGG,?O^ui>H疓W/>x}w\ڧ1uH O1EHzT/QZRN[ٯjL${&/CQVL/_X>Ĝ& $Fv|X*@Z 3ufJ7 b"f~Xo}Q@6.XWJ{Qɶ:0 2ڤb1 AEZ69s Z*PhGFu+`qw-iuUy]d+Цb^S.EABrp2[lЫX3 C%]L,dSN?g "cԀt=1\ۧ|FF09S6(lج[ܲ!']FBnAc`w L!!&a7:ROY {vj?vǛ||)hSZ6pl :HCī{m-ZԱ~{8QQO:d\;nf BO?} ; 71bn{62|TM~0ɂb_ NVY#3 az.[Ga [^5}M8(C/Hi"նq (6cH9(]>7ǼkSY\Ĺž?CJ:tфfz̰[)GL ƨ'd?f?_M22տ;-@c?%=<Ϗ} E4;сж"9A={|8's#\"+`uhYX== 8}V`gu&|\|~/AC],poWpem_=Nct<y? {n)"spph{_p30GpMpV~; ׽nsasEt Ahc[] h;ucˠ]mnx_`m=hVAA@m5 kB;MA[5k6oơmcخǿWfh]wuNcݭdzzh~YߗAۢN=zw,c%=ΥI:}2ݖZZ98Oz~3c٪,mNv~G<\V}s>O?sF>눞7D9`uCq*3.~wYV'>kZCϹKYޏT9"} h+q@[ǹng<0Z=.<~7W0NU]Fns=ѿw@~&'7ǶnS-ǘ ףש?z<Fhn׿;t{n?z~ ^omG:힁>\W\elmTcS}L76cJ1(+|׿=}oV&[\ߓׯ#vw]|{3Hɺ Y%׼wϴ>\?ǴXy <9>>ڼ ^v!?zz%=zLMqLf>ܺzkFs+_szܸg\kQV{Z?)~gh¿z|܏1zz.'_cN/fCnn`ά~3c/׾M aaDSu30z^_P'пC{Q_{Fw2xϼc=< 8eF3xkU\ǘFyV2>̾u8yXcUvu7kqk=u\ZF1saj]Zψu3S/_3kM7{c5:y?Z{0'|x:П31^fֵAF +"]ŚfNt3\-s\c4|`?h7n;q{>q Ω;p=Oƞ5`1xXxbp7pcA8ϭ1sjWcerp"͵y^/>9ѝz+ÞȭߦΕ+x5zyqN =`_6.ɭ9~orn1\|Vq,>v"Wu Zl,Wf]<̻8H݁\g \.{o{|4^ Oe؉[ F ''>Md5< ~2}XQ$hF鿹/=~P(kyO=~Dߏ׌r%+ôgHf3cӖ==c63ӭ{LKХ6nAe;opfܧFnsݍXV> 6KwsQn+6׭vsiYvg9xj-'MYAw5k]}wC+X}mCú_13#zsя}̻s?iT53seÔoo1tMfl85d/qVn<ϼGӚOpf3V_5&q_q{ƭf9:aep2V{52 =io}9ŘF<^#1{vP^lkCzNPbt]|s:fl>_wZb_\gt6]~3EHgYsz F6tխu51z? \mX1?ukPn54Ζ1a֥pYtӦ'^ lƶ`!M3kfC[i߃oC V?Z[_gh9?d]c9] ΩX=NM+]܇T57]*WsX_k;?b9}mq^2{ 1=3mc#V_vߦWQ̳6x8Ҧ~=MݷƼKHÚٕ[{ aisIFO{jP YsCwil85an=O5v5c5)̜}U۸b6g_od> dd)f|ZgsշyO_1t{9Wmzגu~3ᗂgccv {bѬU?#Y2aƼ҆w\"7 # f6,g}fkQ`ޟ y?n13Ow0lgYy> ֻ+G` ̳Uyxu4"̵1mkh_/sކ'ڰg^/{ |流laǬי9;pޯpț DD#AW1`.R)Y.U\HjD"J-R\w/~>$Ys^k1s1sd+Y*PCHWL˶W]hB/ƵVҺެ')GMX-;"Hi>Rm(௮y;y)##9wX0=ԁӢb܊e+]++\8m✴<\[`LjjFsi/a<@a3lbøp+֓1\}c1gx ヤ4Bo?0Yh2.L!%Xo/]j(/L>[eNt㽚uԫ7U뾾nL{"^PWB)^2C϶ҿms Ѯby=\smU:@Lg9>.( uah\O-o epraZob<;q61ϲOK?`$*y?5bϒvًra 'Z'qMZtsоSp*,̞#mJsZ%!#5ilZ{[gige:+:u>iMl̒A\'(hz2{wp޽fm6敬KaגV(ʆMk[{DR= 3.BYd5!MҰ_K Q!u;$rA{*/~IfKշQTfwUC}&u(XɬlK/$F=j\tZs#;|h^+DmgC.KHvhL3{L{kЮ|?M=e6ʒ P< hfFkq2#m=̟Bњnkk4:j=W4[ceTCqʲ诒nџw'T4y"ۥ'(pn}>;m*_?jGCE>(iAZ!z\!IgmQwqy|Gy}A=зò=\o"TC.K 0{S2{Umi8V|'bg0U3Zl?{CH1ضC/c9#}c'mtgҁlǒN(vY^hlb #4O;3SՆXl)LG>C{Ϲ87X/=?s,0[XgC`g(bts/KATC^C(}sy-yȾ|mTyBoTi>\GPO }z<OaW.G׃ؗ"_?Vt2bs2k-9&T'B[hNSYlK%Ǻsr=~鴘 ^u}y;Us)Ǧ[3˄?o6\Qnjc:ヺ\5oL^Z>Zr>cj>kMʌ5/ɧ3o:ԧm+|Ti%]ꂘ]&;>Ǩk/xH~+'_oQޱ1q@~=bD 393A;IA}YxnN=rۣz(Zg@u+s -DP ru@_W|ܨѷ?yΎtKg9pv]ql-t0eH:EФҦ{vϞ/̞+!m[vs}Q|=ݻ5]2B W3X'sDz?KGghl}fFw;̶Q {퐯sgoUZab0t}sgAm<_acZS梾K49c>[2(/NMW2/rZ\op澢]]_;{iFzrF>wHT ?+I.ʆ/;p.9-+>=M3yhXv;gChms̹l0]v;]=>@{OMWlmVl,9Hz[_w}rԳV~,?w=& C~|\DYvúg} eA:1;4zJ>W!O՘B(Ӷj9c}):'&[Na>-p-,^X]t.])Kg_>b}A]E;XS[O6ʤq=C.yr7ߤdc{cz:T]ncL=Ͻz/|123gPЯ2{-nDW>uҹ鵾X ^wdUW5'K^{&n'RkN9}zi^k1׻ӛ/R$Xy^\3xsߜcJ^^Y5G~dlj<m; \y}SA] <\3:P/aPd'Ir4-K&By03cVB~u.]̾U;bgTCQ.6~ӋE2/]KOB[;+hٷ[.˹zlc: }TS~3e:~r#\Oq-0$c}aֳaW%bc"=jlɞ虯BGZ;m)F0&ζzRבy KO*(>~3>$&Ŷ-m4u~q<7m͡J~$9385/jfeXDik('g+գPOu [`;uͺ β$6g_K{K򽁲9gg:ɏG#= E&_؇z?Sp~E\]0-?zdyhCLX8nXYK)}xIWu._YaliʱIX۫y˲#MW3Ysx˪cv>e|=;ԧmWBя:~2E{1j㠍Mm p/ y(}!FmlǸ ;I߀v0V)5ă!Fhm>O@1(.SE[ݤJ=5,Oke|1/S0B̸TY=U&AKJ㷉koQn4f4{p|ұwәH-8Ԍ}u6i/Ly|2D}:9=?y_p$?R)c~k55{usp~9yʎI~髉Pr#|_F}ׇ9ע9)+6RG|9cq+ҍkIn(Ӝq}u A7}D&z-ڢlV93z$>&crS5аѿ~bɾ@z>x:?s^/M>UbUm1Q,ׯc9`#> y cLwY\ΣR bry6*}MʘRm):,Gab薥s|:rN6>]L\Q yKǡoJ?"/ҡޣߥ߮skBM c]gDUBoKYK<ytYK ^7Hy~בY ʿ;ok)c>ϴA;?|u✟~3}cAO?R r"c)3vD?kP5^C~,@=9N=ߜkzTsB>r;O߹V\CbL;C漌f# kewk}:7vC)($^4-7k#0B{ݍVW9v4\ yp_>]WnO~1RAܳ; VA}OC=.[[`b$ZqTtȈc]H{=j4A{Yl3 &2$czIhPë=^<|y_=ǦvAi>zZG3< 2&}#ߑпףb>ǒ/Qխ>Sy|OR}s Kvs$Uҏ!/sCǷjeq'M߈~"1\O>osTʎoXq~B6IL 7>3|t_mnZٕ7_ܲgCn?.h_,~uyL#|FZ3sX{9>6u-h;{{_39~si<𸚗u"ߛFrQA:@Pβ=k]tObdh;Z:)T#&>ު{O]ñrceҶmCx\Q{A?υ6-+'q4G}sa t\Kv=&ϵo*;2kP>xƗN\K{ MQ,hߑi_"Q.3J>ۯ ^Fo1Ps>)}e!O eN,ZWriRKFI۟j}F|ܑ?P=JA7"eA߯eǼ)'͟ыϤMʢ'c|Ab^4L;z;P~^g}[8jZSC'/y E{ nZ({V?6`/*tU߀d{OkZLrsCԵ/`Y-a~"O[\֕qH}H]=[#lQ;y@7C} Ƕ1ñDC~jeHV2uovF^_ln>9ס'! 4 ?>yl8k*[ܻђHwo|݂:z*7~7KOQ?06#F9Ti*ji=A[s:2@ 'Thx! SqN ; sF Y~%BWV{ߕCcIa\9/Ljmd<E{43}'o dﯺŵVR l/󹧫[KlxahQK~8Oyy!^~ZM?Pg[H閕ߴ4M+f]VV0x{{u۰*Is-ևyIIv?Z2^ +sjzP /cO_GykB?fi8VcB mu宿歹"A~X}D ާ4`j.>ZRrǹ̎B>Zk> Ӳt꠻͐X>Lo]~k=ʑ6md=mm=r_rLeͭ"/_wԧͷi>yG!Ze+0ʔ<}*ΏUA'/ԎCW/uRyqg7P>ohbb-IyL6ǫ`LT~r}6Ƶ1ϸ^SoO2ψcգfj({y&1qު^C\f/h\2ƠεvVgƌԙ_OWvS9~(3˔?NtSóI,:v5ڢשzdv(ci36>!>aZ]20u$?ܞyjcg{ޘy3eJr}ZG*},,v'qϩEҳƓb8oP_foh7\FϨX/cZ9ΣJ譯5Y,׬bX>0j~W8MtkNL ])Gy%;iHm17UA;Q'eU/wnZiz(qgQ{Ao^Y[Y>m"uD7] :0>M;]AFyOF]ݶt>uDzʋʔO9Z5. *x$~CSאG ~`Pf5nt ~)=cBm9s١oõך:ec.u/iMmE/WMy+V@( -euؗ4p7*[sZ13No,K&ZGsОqS~##KpJc >Ʌ >E7#ﯘ{_Pw+HGIYf4\Z~w@9䗞o|xmБTZ^_~*:czUc_me{ }ϔ9Iz|Mcÿ C[Lթ2 |)uC(>?>פ "M'|z,9X._/<>}Az*m}UB/?|! ;[Bq ˭?1iӖU/㐿8e7 G{s*?e|w束*ג`H6bn)Jk~o4kFϽi}!6vm59_rvm{͞׬UiDhy{/-gџΏX^14CJ3P{x~a3R8/c_K(UiOm~g3.2cL@D3'on3_Z@~x퉍;דʏkM圛4&5ݲ{KmjVvgq_~l 昍c#ݫ>|7Xj]X9fsO)VC^^o|k燧YË#:? ̘\`<1V˳^}+GnTU^iy4sC3u5a,\wM>6V( Ycܧ=H؆R򥧴7{)aw<5Pk`__ܣ柆4|.~` G4ӕk\ϙ!?*m 9'5LҚrUlQ{}l}?Do4|Eלw?+񒶑sq>3^է܃~'m # E}۰ ǒCqPO l#>U :cju+}m$sчR]BQ7y̷o<̶Qm e)ҷvѲ#>!A9[ l &a_OX9v8SyF>vެ /iP]|~:MS{Y5C]VϙF*ǖ}6e?~U3롷oݶ#߅sC2}sT>uXҹ?eRcysk{ vO}f zbfv_='A_Ji͠]Sg7]6oU'lՋ!UҹՐe7aiέYپ1/u=uziH[ ŵ[ɠl `ol_~-{2?pO B~l(@yD{xGEG{%y.N3y޼8Vu_=i*\׌F6_7n}}&b{HhxN.2|mxD>穟Q>0vZ%cYOiMex*-纔[A}NW KqelHXundKPTuK\mtige+gd۫˶Pv8tO<>tS(3b=:dꊕgC5fz8b?,~i#ף>pYRz \O~"˕O͢N#SOX{z/]¸3}N:\$+ޡ̵Pj#eIS.+ֵF(fhiO}G>S}bkWԁ}S#%}ACuu}߲29Y źqP7aϟ!4wo ȵ>*ӹx~#M5U&8ܞԇ ϵ~>`yNC9ri^^kmUsB;LE܃>Z$GYuM}6Hy/B>>g{-P6FSXI[ C[73<3}w;;7IC3}7zi`[,o.oJڿ=߳3_ؗL#{6wANu?8P[n="c]_ҿeQ,gѧy<Z!?Sk/|Z#ߤbϵPG[7Xw_7Pjl3 y~+WYZ_}HsUXoz-y gLhqg{1,!1^VGYu0✑>lg<0:m/Yuߟbci}ςʿZ?q -?ZJC=9We7RZ8ջg]GioX 58 U:ǭ YJ5E:z/XF$o=B}~rj11ؑ:>9GeGrAZlj E] }{crq~l k=Mtһz=&@9lO;h7JW3tr{e04jp x{b<:&Q uWF|aܫ@|9ל{^q;E>;s'_M9192[?+&Oƕ˜=4ԇ7<=Sc|<1YO ?QiXWҰnacs^5ZUXZ '1v:qzFcSvp\RVG1{O/OL.'#b4.<46W?6&Kj/im~<~6Qs)V~I-c$t#en︷PKo=>o_L>.(&S10vK> }]_㞚8w~ )4ԩl-؈t+ eLBQҿۣL=(?}輢lHZXO|R̰HkR}һ|~Т{kru1ݟe<-S얱+Rw Z>1N _9y|,n=-BC9ge\*z|qti>'P,N|8LXAeTzHs>3@)ʠ', {W>SgP=s7 nuɢtBnwuh4bM]35h5nSdPfCµreU#Π^٨Cb _> cUCjgkٸVj_;9yz>^7ٕ+۵esoKuRܔJ]xTL<>z-/tlT>dt^^ L䟁߳k۫7-H&8&V{]Tځ;6j>sžY:8b|ʽ,(%Yb|owUuvK:801z29)ۛ%G|Q:RY>&=ƵH񫑕q+H,|wYίtIiƠ_#3ix}Gj(?{;0K(93MU{fd~|5+3{wpFsNVTc:83{k/`wpBD]3i9=c;87fe=TrtOYTK"NףS9yY@_YNnKӽ61Y;8=ʌf~w>x~c>mߑ=K4k3^tpZv?-o:ɞ"fMqnVƑYiz%jo9퓷eu;8{2YYkC.igɺ3<ޡ{:Cv.Nΰ#,QDU֖(QĆC:4%J袹gVtk;Sxd^L?3:{1{V9caql柕ckr,JW;3-;NܸqIKW&K$yP'r,{.ǮƱSIaρxcUmI_=kc/wwqЅE|׺ ǡ7&a9S8qqđ 㨏uqL_x9޾;\t'8"us8s7μdbp֚Ǫ6ޛt?UbSq9.o#`m">_=$$$^=nТ>v]\٩Uuqakƀ?tڵ]$EpgOܔǎOMyק:Ogn ]Ń}I/+I|+⦅]׋>4IqwX|3ZvN[ٴp߉qee9ǃ'C.~"صGћؼq৽xO$O^x\5哋gg?O,gO+; ,NOB嶑Q[EcG"ZqJsLkVL>p0󪩅{{yYĂ?/QDw%˺Xʼn{GGүlxtxiedlFenOo\,hl󑩋W_b">&a+,1xq^#r8t_o?޲wGyG>vǏ^صS}qjbGzqFlj+Jp%Jly8e8uq9S۰Xvs~o19utUY?;z,U𷋓]DD4.Xw8ᔱ]!#nx<'/?adžt<ݴ=ϟ+6>}Q >׋Ƃ.ZC+'?(bo;sj`S&^=XaCK#G']><1Xc;F/;^qsūū;^sc{zbpnI堏$Cn]3:;?⎱.o=vmohr &'^{k862μub 7L V2>)<5:~wy9.yL*`_95W]bWcJl].>ɛ{gSw渹1كwN> u5.E#Mu|/.I*ߞǏj|w;{wWL wy~5vk/1M^D }J7OL|CEjjs_||aŗvJ(p?սGǝ+8ڍyj|%J(1X{GFR8D ^]s{/x]c×L,s(1G pk7.eoxدDM ORO~q돟*1 ߴq{&/6Q WN-?2Ѽ%Ƃ C7b'^35v^Ǽ&2~,3u]qcۧ&vWe>v_49sM{]8>}k⵿K(Q;7܋7>'#폣-bʤv~]wdR[ٙW/޹N/8Eqbg22V={ǹ߮ <~蠩pǥ_)Oݰ}?|dgvG;7-\}⚛GƟ$qJL4'~~7^3>B 7_bSgV[:mKyAR‰]|Ú[KL4Ⱥ+7L> Hn[(Qb;g*u%J(Q}|uc-QbN<~8?z&2D'>eOj~_O/♳ƇgY׳%J(QbK/Vm97sҋ-]T" ]*bI}.݋ʺc^Y$9۞c᭽X|Q/<29-;l:%&b׎~٤x7DZu>WkWprp@GܱCoXn8lF/<0qyG-cp ]5:߿?Ni'P懓w(Qb)q~]qqq]}YO\?wH wn[7|` GǥewtN.??84.Guq+69"#O׋OIMާĖ,pۖX~X|c%_>?W.&=ԿqnRkMS ߺD%J(Qb7s{vrq-PbKJLu|^9>aIostr<ޚnx |2g,KL^XQ@#62*./G{%JX7 .Obcǜ-s-QD?{DCG?^L.m%J(QD%J(Q憥ox[^o%JG-> endobj 66 0 obj << /Type /Font /Subtype /CIDFontType2 /BaseFont /#4F#44#4C#5A#41#46#2B#46#5A#44#42#53#4A#57#2D#2D#47#42#31#2D#30 /CIDSystemInfo << /Ordering(Identity) /Registry(Adobe) /Supplement 4 >> /FontDescriptor 67 0 R /DW 1000 /W [694[1000]697[1000]767[1000]820[1000]834[1000]855[1000]883[1000]947[1000]950[1000]1050[1000]1056[1000]1109[1000]1138[1000]1190[1000]1198[1000]1232[1000]1256[1000]1318[1000]1407[1000]1689[1000]1696[1000]1777[1000]1847[1000]1854[1000]1885[1000]2038[1000]2136[1000]2233[1000]2343[1000]2471[1000]2507[1000]2566[1000]2631[1000]2665[1000]2692[1000]2827[1000]2829[1000]2995[1000]3011[1000]3718[1000]4140[1000]4226[1000]4535[1000]4945[1000]5136[1000]5856[1000]5889[1000]5994[1000]6017[1000]6075[1000]6082[1000]6400[1000]6401[1000]6408[1000]6409[1000]6849[1000]] >> endobj 68 0 obj << /Length 69 0 R /Filter/FlateDecode >> stream xUI0{ Aǖ}7ȡ Mڻl˩q+= |gFEu ŏ֟ƒ<~{} ]L3a SȂR> endobj 70 0 obj << /Filter /FlateDecode /Length 71 0 R /Length1 72 0 R >> stream xwTi0|LWczIQ)*`b`DU4dIoMӓI&=p|̜g߻{_\ `~(AM:ce+GIBÈd6f 1 pcҏ#_ǐ(tV?'>Lĥ+&ϏN(7J hHWr|]: ԣZ.;`ǁ'µߏG5YQצm:vܥk=zݧo`|]πQQQ}FMZKԖQ.E]u#Vԝ66)mN9pSځځE=ˉŊc%XK=G[ؗoc ^ ^`$ ƃI`*8oE,+\]x7Q )YGgoqm:u'nh1q&M7;nqҸqāqq8T\J>50'SǙqCqǝ;w&Bܥkq7Ž @:@:ACzAB@CFAFCA&AACCVBVCB6B@I !"$ Ɇ0 ,H‡CJ H5DQA=B:ȯ}C#s+ېH#-4 ::: :::: :  t4"Xh*%AiPt+ CbhT AP- uC=P4 === = >~~6â`aaa`CaѰ1I)ٰ%尕5uXX< Ka0*ˇRXVS´0=]=}cSs+kz}X#  {|T|n=?&~|Ys/_<G#xf|~|q|ExS'~WWߎ(Y7owwOπφ//opx <Ng)L8 χ;jnNxw  o?K$I5{B F$J0)aF܄5 [ ЄT>PK$%$HP% 'Kp5Q &OhhXXXX؀؄!  #&؊"Ĉm bBP"t ‰ =}3+j&s'DsbTbn&J8:qlYs%.I\.qc",11HLLOMK,LܞNt$w&NR +UH ҄#H2܉܍<<<<:~~~ 3333 333 0dL*0LVL!F)H01UFb ƊŸ1ǜ\\4``^cac>DtH3ʐ1)S&,O%ec` 8M!d0RrSJSSR)Wʮ)GRNIr%1寔fll'l PHl v,vv vvv>v%v5vbIXҰL,bmXVZXև݉݃=====>>¾~6:zz&&fV6bq0qi8*.8>n 'mp gYp\΋ vN..^Ľý}}Km>[j~RGJ:)ujEKSL%ucj\*45!JLMKSRESeT]9՞ZMݙ;uoRK=z!R{R6>Ay x#Ix',|ŋeJkzov{{g/Oo B[BBB7BOB`pB4a,aa*a:a&aa aa%a5a3D hB !@ Y:!G( BPF$ ZB-$!$$%4^>>Į^āġđq ĩęĹEĥu D0B'")D<1H!fiD1O,$BXB,%JDQEMD $^bxxxxx@|@|L|B|N|C|GFړzzF&f֑66$0 FJ#e\$ *H;HrR &yINo#S3sK[CK_ϤiQiӺH'-:mLԴis-M[* OKLCapi4jZv;-?OIҪi4g;͗Lە/p鴳i.]I֐"ϴoi]L>!}RsӗI_HOJOIǧgӹty!ݞ1>cVE2Vgؐ9AH`gg3D u1Ñ3cWơ#2d#z͌3exWƧo$ ,\R*zFr,FSȩtr9L'3lrY@.&RrYIVd#Fv!1iYum=Ccr -#;%Ҏґҍ҃҇222222222 eDR)H (J:%B(>RB)S*)5H1SOIMrrrrrrrHyNyIyCyK@DJmOBAMGHBNEKHLJNEC]@]D]CRxj5fPBZL-J P-TAP uu EUu-j# Sf3{fό99sj̙3e.\)sKfB&2$dR3s2陬̼LafIfy&Әi d'#2/e˼*wЬYsfme(YYY,VV~7(k[Vy,Y2Ked=d鬛Ye=z*C֧o]{e=${\yk7fof#Q٩٤lj6-5[-"*[mȮvewf=|١ٟr: ϙ3)gJ̜9s,%gKN\N|"')'9!d0rrx9œINE};Ǜٓs4d 9r̹s?Iλ9_iQ.X4LBrZ,-ahZ&&h%RZ9&izZ NsҼmm7i9EM=Z1-D{B{Aޖށޅދ>CG@DBFAG_B_It$Mг:.rv^%=zh˘Șʘ͘XXXXXb@HalF!C(f2*U 9C2 8888ǸĸƸ͸xhbS3KJduL?3<<<<<ͼļ¼ͬg>fb|.snCrscrN̝;=wA%+sW&r \r.;[[=א[kɵ:r]@}r˽{'aPܗos~daufugac b a gdfgMdMe`a-a-c`egmfY8̢rY,UΪd`)XedXdadfca]`]ed5dc}`}fG۳Gǰ簗Wױ7!l8Ʋldyl]Vm{ 0wq)9%U v=;~~~~k!k^~yȋ7;o~¼yyYy<^08O'۞yy@ޡ3yn5=k{*s޷fN;NN'NWNONoN`PN4ggg gg&g6ggg gg-g=gg3's8IdP99'p8.#H99G˩9>Nssssssssyyy1[~#O_2K>=k~I|E>&ߒȯ?8X̿ߐߔ*c]Fo:~ӷRnn+X\`}@].-ZY΅= +\PpUBp!00]-L/ مmeUB}\h+ (ahn ww&w6ww1w)w9w5ww 7 &pl.+䊸%2j5\ p ww/(8<:>1=#3  ooooo o:ooooof%0<~a e5 M|?GI,>/B_ʯo+Zo[>~*>EYMS[_0P0L0A0U0]0S0OHDBZ^A' A%*(; FNAPWp@pXpLpBpZpVO'7appppppp, !N&4!S a\(*QA^!aQi9Ee5]aQ\ZU\ԭwQߢECF*RhuƢ"D(TSD/*4E"GhWўE.].ZtQѓ/E{(_Nn^~!QqYےz#I/ɷ]ʻ,W>|t)g-_T|UMqrByZ9<<^,//,ʥUr]S/[~"BS0U+_+T8RqdW+nVW}҃cҋһ&3 +;G6*W]9rfՕ*c+*ᕉJ|ez%2]YXYT),TnTW*ʝ{+OTb붟ܱlGw\ZVQ%W:_ufCGVUzUjD5RMfVV?. #(".)MM͓-mm`$ZedY,WV,JeTV%S42+ ~!$*k=}}}G;{ȇG'ɧggʗ!x9B$Gɱr۪;{GGgת7AjjTSٮh4vSS٭99<Ѝ֍MM--mցt`LCPTE u|XWۡ:.ۭۧ;;;CwQwEwCwWנ{{ ^>{{1)e5z/ӫŏEŏKo{\#+KW>lk4BaƄFDcbcR#Gh4!414)494%454-4=4#434+4;4'474/4? 0(8$4,GBPM2,!k C3 Cu!O@(5+;'7G  5PsSTSM7uhԩsSMݚ7hkQ6?nn3xV5]T^}=,"5Jڢ:>fZ̜bbRc}Ō5=>ڇ0N3X98h  8Ԣ K &a}͊X **h:~N^!)9Ee]}C`)5O_-44J_uKX_ \D_3A4 Յwiyu-Н6^n}ױbͱVʌW[X_F1yD_;Du9x5B[k8 Ls\pX .oW`uX_`' S3-Wqu7 &M 뼸q6m+E_qq~iמ}]Y  ! Ar#*@J[k mÐa} <4A|FAB;@;AACBCGCA'CgB@@׍Xh4E_ (E_K*ְ"zzzzzzz'3kX_;:zF5&"  5#0ƅ"i`Ga`gaa`w{ {3lʉ//ފ?wwlV'W&Kjn ;GgW7w-1~Vf$$p#=AKI_C xD԰G,ADAGlB`E_i&؊!! Qkwm[ȈlZ+=DG? ?}M$Iؤ$rRVrI҈ʓ I$oR iwҁ#IGz)nG}آ/Ð11- W #l$Y!2Y!kv3Zk?S$/M^E_3E_&O~,ePQa}ZZZڌ5v)v5v=vW6E_ Bl [UaX3뾰Ş^^^c`cc`bcp#:777) qKqpkqpp0 W .U+Õk ΂\8/.k!Ik}5O3oa}J_C_YTa(2E_]a}J_υ4b2Z/}5/:}ǟ__ cskB߰$%}D~W*N`M_e-J_oGWwbI_'uND_W!n&#"$"ỈkUNT5h#:n $&Nxx"%~#6ړ:zu@X_'f擖V~ k, B„ע}$פHZ{X_G/kq$*MN}oK#/*3#: .ذr2x% UX_a}=ܢ"'w'$%"$"!#O#" :r,JȩdR+}J摋brE_Md;MwOrX_sD_FupD_'QQfuqX_R6RPD+}MP)tJnD_}AQSJ!Qʙޠܥ4Y+}n^~a}nB~ZD-VC_} W^}{GԦoX_'UY/z1^fCˬYC~׌,FX_ JZd9+k_oa}Ƭg-9e˞}%dSslʿ댜}]'}M!P)lkWW''kᜓ9ZkCNS9[kP(XĈΧ-ku4?mmoX_O}mOLIBm[AGI/sVHIGdt\|Ƣ}2 WV+}dT1d %C3L 'qq"W"xxhI_22G2cc:;˘E_뱰c^a^K;}#:!s")\RnF.;wk0,2WW}}ՙՍ՛Տ555,cYYS: c%[,rz[Eeu_v<;1İ\a`J_/F!1ZMX_.I_yyVUiy'$2:_ɯ7՗'X_O?5/,8Ppqυ] {Bh!<)Bja6B?m.ۖ5":6s#E_ӸB[-FUs\;Eu?8,&>7}ׯa}ly<Ѣ^cVOwP($tE_>5~%_̯ׄzo%&!-'("/ق}]' DJ 8n(갾 _C_OVA5Äc$fWE_O /D^PEV7}e k]uKf]-bSU)FxWo.ů?h`D_GM_}WkP}]#1IѢ[|J.,_Z|MrpD_׊:[PQTU*j+ް8\qD +nTܮxP񨢩EX_?T|ݥ=CåSs ˤ+# ¥IRlX_)RtP}5FNѰm}ic+}֢1uCD_+S**ɕJzֈVJ+U5Jwe0*}-^%RVPuvUkQT/^Szsu|uRuJufX__N~aQa})[,[.[%[#$A"KJEBV%eɎNF) ww./ǵ+&VZ/("+KP)*;2JaVW\T\UPS" +QIW)JrR+YES UT*J_.VTI_y"MFj4*NԸ5^^Ӛ˚; 麙:`X_DJtY:@׉t?끰m]}D_KX_/TF/ JqOZ끿kh~/m}Q 7m45W4yfv39֌mNj*80!???????^_w~~_U~_K_E~gY~)~?ݟ'~?Տc~?C77WWggc~>.O?}o|/|}O|M{˾3}|}{}{||;}A|5>O>OSj_oo'$2_O+ }|ϗcr} ݗe>/Ň%|0;M u5վUe%E9پYi) qQhH____o_/_O___g_'_G_{_;o/;[Wޗ&owa!A~No>ZF֫* v[-yKboWy^7˛z)^7Û{^7ً½^x㼱^wwwwwwwwwwwwwwwww7;yyy9ͳX=fO1xTGlH=OԓaylOI=ޓA{Py'==>>>>>>}nvn6uJw[.sos^gwkV^c7v]eWejv^nKb{ojgٙvj3vod;ҞhOvdb`ž޾ƾھʾ¾̾ԾؾȾо>>>>>manfj`okcejh`o[swok_ޭZ{r j=X6PjkZQmQ-QSK%k jίW;vvj'NP;6vxj]ۥSmmklͶ/7׶Wg'vvvvvvvvvvvmm-h |6ms,6Mo46MnJml"[g+qly6ah,[d#6-Ն6-نm6 lm----ͷͳͲʹMMMEFF؆zٺ:::YYZ?YY[Y׭׬Wg'G{AkuVi5[MΪʬ*+JfX D+ @&:* r"B\ltd$`k_kkOkkwkWkk'kGkk{k;k['{_7זg=- e%9YI1a~n.˯c,NRc1XtEi[dj"YYDE`YZ%B`-fYlYdeadhogcmfjl`ocmebldh`ig??ߛ23i~a~n~boo/ϙϚϘOO71f>de2͵fj6fYk֘;r\f.5f9L3gfl0$3ʜlM eiIqa~.润OLޘ^.ΘN&f̦1L S$1JMb5Sj"MD֔hBLp4m2-7-6403 135u7u3u2u4V}˚PMc{5k֜9Qsf_ޚ5Kff5jk X3_MXoed6<44n..NN~716f8hokm<`6 ޠ5h Pm2T 0 BGK #_u;u>Wֹt:FtJ'ѕJubHW:.GХt$]K666fu#u#tut]u]tumߵߴ_i_kk ڛk ?gkhZ֪hjmMӒDm6EѢ(-\ jh7i7j7hѮ׮Ѯ....NNNNҎvvж4kki>i>jij^hih445w544W5445g45'55G5iƫqiF٦)4| OS٪akM&]!j&EAj٢٠EFZJ\X3Y3I3A3F3T_WG[KSCMQVZJRBݠ>>>>>ޯjZjfjNS1jNT#pu:V R[ԛ՛ԿרWW竧ǪǨG{{{;;۪ۨ/Ϫw?UU/UTOUOTUU۪[+s3㪣UUTT{U{TT]U2jT:\U*SmSUE* T[U["RU8BWTPDVŪ@-%Ūy٪ip`UU/UOUUWUUGeOkKew!~.ʝZ^Qʕ2eJCY(˔b%_UnU+9<%[R2t%MT4%I)J2YT&*a ʕʥYiʩIʉqʱ1ʡʁʾʮʎv([k3SEQѠ88+ ©) BP* ZQ*Jb@SlU "AQ)XPYIQ^VZTHP@1_1O1W1M1E1Y1Q1A1Nhț/M sc=< ʝrZ^*/r<_ΑȳruO>U?u֩vjکScFN*Nc};=??汗>vcw~eZm>V^Y\}W[}ݫw޼z ׯZ=zeV/Yݳz9;Wwn_ݴ:::::ZY-V3j:*Ziֿ/zZߵ֗Z_h}_Z[kֻZolXjVZ˭|ŭZG[GZ3i=z~[m=;ܺuWI[nnغu}֡E=[給[[Z[[ZkkU[Vke[a+h9-%i/?oͯ7Ǜ懛o;|k?nk櫚l6[͕r|IsyyP泛h׼yO)'7n|b6onԼy}+W4/o^׼y~9f9h5{=j,7 \3L~kMVc+?]WW[ʗWϮ|fS+\GWr#+ZW޳򎕷yV޸+WlrbѕGV_oi+;WXm +ܲr5+W\e+{V[ٶeeʆJJJJe%]IVo^_/h{]//rcw.},be˫˭,.?\~ӗ[oZqZޱyyx9ZiG5zk4bS6>`=w4oik+/knTXjh,6^88ژm4^x~m<`ٍhxj)w6ظqCơՍ6.i81o4zFiD6솹tz?~.}wK__/.}vK^޽ƥ/vUK/_Z]ZZz҉KK.YYzdKYzpKZzӖtK-ݸtҵKW/]oiEK/tΥK[jKKKKCKKRf)XO_/?;Γ8'~;ܓ|g|{Os't'=y%ϼc/%S'~q''NN{Nىwx׉o<'^}'VO<GO'w'y,~{񛋏/~c_[ſ_?׋]{ߵGo\7,-v5X|[l-6/Y{^|_\~_Ћ{QE?8s{;>67̽lwN=6:2ט;9wls=4ܹYsϘo޹;n~s殜bK홻`s[6m 9wΙ9u_Ǐ}?ڱ?c_8c}>~c;zqlXXr,> <_?OG藏ێ6>G8ģ}[r7G8z٣GfϾpϙYϜo'9{fo~UghvٳSf7gެ5kYGW||g|ȧ|_葿<#~G{ώk摙g?f;3Ϟ3Ooi33󔙻gyƙkg\9s̞sfl͌ Tf3Lv&goF>}7z'|_??rqG_1WMz5ӯ~7׿YVԿ[^XQd}ި/WzZ>Uקgϩ[?~~=/_Z~yWMx'S?M|Sԯ}?s꿦~3u.겮Fݬ[uݺWA=G3l=W bT/+j]kp8}mox~y%E"?/w1]MLORUS)RdL`HyJIdIȢODR|N\w-e<]m?spDZcc;<B´+-CU)C3vlCKccevHՖ{c+l+.a(,_ NޜF`^8: .E* ?"dȝYƂ=}(SۣK/;1!F2J*'u#RCa+EU͠jᒥ`BV̀'l OsFqI=0Vb#1%5*)U]*5LrV"8`Ckh` Sz /6svqX^ 5F*Zv`ޮsשKkOվ֞XIJ! W2]J6HIS^)6R&x*C=ǐʸ } Ӏ?%nLwa /R[2yN3F&[b%bRÃ1@*7G rZ&X6"eD>s{`h3jm[@!+g`랴c go4ɜ)6֢ ˥59窜D*|31m -ʛl&[/к %ǰ.́H*e%RtAhS>q+&2tp33bA%ع}0N߆#d43!RL$@R+ӦۡeB$ CRLl9v ~Ӝ8ic;g*MC% *ݿAse+iA=bn.x==?m` p;j_0d⤾FP!:F`Ln)&YrQρxF끙Xf9C[Sg;+k-{2n'tv"Eb}%zY9.wȼnS9\d[x}rC&2ؖiȍa%σ<{lh184΅%9DD蔡㍀[d#[|du\ "V 0ra"1"p9!\сћ}:,6Al`xLlj.DxHk]"htRoQlgYOA\9M- ĵ6qh~3uH0v3:E1Dj XJ٦ hRs ~ߔ?Y 4-HZ<0Y ,۶y`W/CXA8k^>G(rU mCCJq⛾l6@#<;&|/ ZƬ`"w۠re_z17wǜ\6ϡ9~Іo/q>l384f8ju~E:cq1Lu)n"pH HXm [E'v2/4 ڠralw"L>IiJ3RUaQE\eqMCXŠ.{Gb0m$#TDALvgr}Nv.8I&  vE4^mWv z{T%aʘ#K[W!1,FYs OVs`-kd#. ^ * r%cP@Y·dq*79nQtH*UU]>avLڄ^Gɫ8ASے8 oȇVKs5YKXa#vyp9dVFz;󖈝6^x}R><AHigqlcjl*Kc3NφCY˞cD1 s"F1-`Y1K} RYɵe"@~4Ay,]aH1aerWtTѸي "gF {`@fhI;vwg@Md!ESDT][ȃj 3e~8^P/+m8jA* oYOO cNF'TK#gLԴa)G(ڷk057J r b3@m ሉ?*fa%@C7rZkM_\ٰSVl2F +W@r|ìAb 2\q$t}.Qw9 ~1 c.{-QN;u[RkOOBѿ6Q^{)D682P*8eBL)pwooV}p "MQ=Ǔ 17|mB.9+0s!D T/{hLׂ ^u@g$)԰(iJeNK te/č-@9 +3+/ .7' ?_/ޮ--!i@_cOwr?J5m7p,S b@-@ @S6Ya 4\b^7KxcP@hM5b;r"594KpN e6O*5<!ra`UᎫ9P "Ss(l4fg1w0 ^&1ae.JW }*\@8P\&nRbW)`~®4Yf6<ޟI32! iKy@l^Ȋ Zzs#f5`y!9442A֍m$a>:[jtuswӜvγ 0ES^4O Q/ A8YI C_tUDm0LZέMs\QWvc<:C`aLr,P$/|8gCL4{2zl$Lʨ \,9jkFyph  x)cc L#gT8׎2ׁjsPzcZPݬbe&I2t6u%rQ|T(N41+l)ÔPҾ".ҫ@P2ཁ03I ;Aq&5CY` 9XȱMhPКa8 B+{ ; > \\Pm:S$׫@5ذ)\.eKr擽 *LfO&PEDD5'#-nJ}ɡp-?Ux:mIIXl`6 Pμ{;,O.Hm3T3Y[1,55 ?hRsOid~קqrk??fafȮ|`bZt[gSkG(Zc) ]^lfm SGlLLSl,U/ڼgBeR#RE^F s9M,rP a+(8˜0SL5^=S,rj2*f໱;={|̏&;}g֩T7,˨ A0}cDm_LvֶdtrLEZCb8,Si`wgvJ,k<ڧS[K;$]bu3Trngm"AÈ #[aSrz~d~ifp58.Qw\vny8;K#4eIeٖF^ E>Eu0/.* y,v-R r G- tP@|$67qP Q7!4|zD̊b}oQr0kN.xS)w 2?[D5SO_\t}v#P~0a3!<1K@W} c)k2-aoy$^F( 2Ė- mc $̴TWϐQ+z7:~1ٯ-cnr4TUeE.@m&OF}aMS`T&fG=IT](vL?VJ57@ A=E0&>o-uCH KXW(A'(zQ b(d?!) T"8#3]BT8tO>o g( >΅ &TBC\XLb류5 k"%j"(x0vvv}Ktζahm&·H^0th5)Qi׳'Jyvx^[EtB=@\5lFZ>jt1D{=pjDE ƕ0G4s>DYPVl Yr"tV~6Č>35؏4DGM"wd7go(1'ポ \0cOCH b1 M7[D韈_#*v:$nO\E'hR&t=!0eR&sP:qNSɡArt\zdu!*8 Y+}SVn2k w .: aL"bup3(Zf7?U8t@ZQɫ1xhbCU(%\"@9Qxx91T[-M?|M#ҽ[[~qAqDQ)v[MJ;sddkҞ{"&e-SYԯn@;s18<-b5ad{< (VUcK΍nLvt9\ n' sg/]+U' ql%YR~Mf\GA9]t7Q Џ U49mGxKhja֌ {x\osEn[۵WZKrQPNf{ K]6f'Rm͑vxrc#(kB °q1/H6 QsMBy@E̗@1 9JzLծm#$f@DρxC ي cPo #߂tה*|qRi. xCkoSǩz; Er]y:l(p=9E08Spނ vϱBeR"dr8=Q]>"mn{,%׍%aMC-Y7Mg,`B?i9PRɜo5a#  ˸W$+O-7p!28pHw`>31lm뜒mE /! ӸB 4 t#iQ޵"5*ClzG^r9^Pig6\=xdrs<\Ŕ;@6b0Kc\\JN3I4bigߖ.rp)4E, @T\8%`8s&@ZX:Idӄ)`>&Dy|ԧEŴ&-Wv_zpyیpgX;E6+]ss- ZϿ*Z0,K1\W$|pq[qLi~<qj. ǀ ˳;w][nl*L>iX%,膽s; TD4Iw$y0g [AnTSC/I|`>_O.qc@mm9! (l;'ˢF:'6wZ1!>ޤ_ᜥ7AbbJ+U ĬW1^ Bd3sFlpQ~uWXPa@S*!߯8c6"'PNB$&1׽Il@ҺQH-=0LTNXrGL{ :<"BzFѱ]4БARlT@}GT @/k'\L-% {{B)Z VZrmHlh6BE)%,>'neiCtV"9ud4'm\xzJ}"p 2@ٙ ؏"??5>h:Kl9HJj ("[Łr<~]{n8̂KY3>OSW:z~2&E5RS*~g+ZYsk*>S)k{RtS#+@>ve.3FN.&\B*jA%>F.G HC8R&p(GKS@c|3$ H/1 h)xeK#"= L%r1(-TZLy(z0Q|>=tG `!;9\2#$I2KG0فMhj)v5 8 ˘lOyqG"  dʌ3k/NQl)Q ÜY0Q[vAObfO1o}Ȁ.i+ke0tsu$%ߊ;\%.`*/kp-3N}.@z>487AqB??_h"}?ZFOI{m9wsL\)m)7+qB6Ϗyrk'[g[b\ˌJ('@gq?\/՟>2~>' o(F|8@oQqeGN*m16m[ A7᮱g^Ί/_Wcr5O/]x]+Ӵ7(R ,caѵ)Q4צ__T7Ktʅ Z`CR/Pqֹܚ* \քt @~׼$ (L ̞C*Unf'z+8js{2"d_ݼ! `'yhȂ ?L؆ eB<\!A". ل`K96 VÕxEET1"FGNm/ŧĝ9qk.ԎCy(;MՈ֚C <-HN쭱zy|CWR<׶?v:[ӼNk V`CqMOੳS&]aUM3oW(F#Oq1߶!,vF%^?0ft$bB>ov%Q|pKQl/D_*z潦e[ bXp/oZ Yy7sӝJGfjbnߵ=gTaf/"ll@Yn]rAڣ 9>է2{vXܟEڌN]>۽HEr{!Bq ]NʍV0."q;>5 n*FqNk?.|Zₐ ,|c\7!sl,xW8HDu''C;Xm-(hF)cZ2-=/{E:#糍~ CpJ>9ױܠ`y,+G{Vky\rQ pϭ]cuk  <=خ <~ l u0`#OMZtzN6qz+| ҩbil QlI-kjq9~w"z۪ x/v^µՆ>NlAqr95 l*FN,dF1\4F}\|W|RĔamMY?jMWJkԾyq~e9o 6e_Kρ"BM¼0#˔]u{1(]Uw I B({¶i_#te~2t͹2w}be˽FjY$b+^;-Y7ka`4N%>!"`M^P 4icZX-tB'A'Ml0MVS;)cOmfafs1jU;# *b>O;pʨ]+]p>ng: Hu| sPe R^d`<϶L:ڀH.$>alX zف(}+@<@@/l?=rT;rSG#oQ\׶ŒiY[s嵋@@EU } n`oת$ *@2fX`xjc} 5lh͔&C&> $Ub,ӰDPrlc#Q)ܙS' Fx <7z B$}Hn{* x"V)…x#@U+]0H*ǻ\?̳Y`}V,U֎Ӑ&`ސ0"?t/>.^ pC0-'U+[ί᤬NMUvtK=-hb tߊ1;,d gSH$p{\ qC&@mDkQQy.:  J# N9eQ|Vj-ي=؊#?TJ*Nw] *rཪ!u#QQiI#zDHs=u=0@Hhmy 6=[B޿{m`՟g=Jq]t%ΆlBg&(5~2'uAXnsm3#P _*Sgo B2`XU\b#_G67+ƽ_T`*E朳.vY2q.+6Xj[J&3[uu4uG &]m2/)'8y[i%0ނ\y~oʋkcf ft\h߅6D Y>r LEt?]'2=?FJ4^HJ؆Qc 4=er7N)g \^]/}dڱJF1)ϭlB3@ʧϿ~)a$ CnHu\_zswd\\/ոϏ=Íge ~o00!( }=( ^|?N"5V. Щ\/[Hs.I|\0t*[qS!Jaq" A,mkL>\bb kph [DgBs?&zS#$fƭO_AVkF)nw_)v vC^"!J>6:QO}r*߅jOfܕ.nTl9w 3q*BṱSP'>W\-f;h&U&K9uwppX"kS˵߁ ^ '0kftu$פYe<@G^1 [A\G+"S{B2A2WJ ; A:sm <X  R`IQbO'qJ-+]b. ,ܲ/~(1"]e3d2m(&ħ%~٭<ګ h<:UMn{!$d5.#`o$?ge]?<P2QAw8hIN܁: *X`=elx3 ,4Z5'+5 \lpcO@!Tڶ4ĄRT&͇cAɻGHc?-.~G?Q6Nÿ|#^SyqCDpķ Pr0+Y8qH!~ϋP< < Q(~^:n2?^  87@~8|2p 1ˡ܏spoG2ЇX?.N+i8> ӟv({W0f_4%C q-? JvpExuޛ)Џ;fxo Cb8s=ƿ,.Hߏ b8q3T8.}\Ŏxb]ǹ]{OGp;ᘂc!8cD1DŽ6F]Os=st.j%ziEpl2]8v }n]V}mcnouOLGwܣ 9 -Sl~?pEz<$}}RoP߃G@}>}u{thOZ'e֊I?!߮ǎs6=9|tt!}?gT]^}n=ة'vlĀiA1禤9ǤǨ>Fgyz3탾gosVߎ} cLx߄kd[^ ۘcުAui}b}.S JIϣ5$ݨhXߋ+g2?DKb]G׉8Re+><Ql&P3gQF9GFrxz|[7Z~ߢW7LJrhYl- {LfU_se=8ks4eXu6kS{}^8ut.'u?u??Hx~1}Zڠv}n>ڠ?o>sa=v= ^Mzk;<๝ d:#;9Es2>1e"]6{Hc [Ey6<}T=}e2z~bFN'7aH!u]tKIK7||=ַHvї=}x}Ar0:OwwI:3-SX[,+k$qg[t]d bdFmLd*cɎl >7_]`eH4?4~jɮI\#2/H_F.'\ٱEˈ ɐd ߠϕ=p2ߩ m&FV2C?GvUQv?Y!\'YRMG@}eu_1NB:i?9 +cȰHH96]^­cٜq#&?Jp; C9sl@/?=(O}<\ݲa2Skzޱk|h$K:+5$g/;a^=*ũ4G8yRY:m|s=&I~Xs|a 5PU6&_j^uÓ?KG|lc9'] 7q~(>#RC> m1xXO"Nv/;1eY'r"$>AKa<ɄuA1@eX;+9#c-To"igye'ƹv?[pNu#I!a&%y@IIq''9Slg,gsA|L:1b9 ټ/;xߋ3Q)b iLd㡞Kn'?QX3><\V/)'@$+q2a-aHSlK(`HydK:MXߐC#cP#|n6Ior}BGV!Y";>8qIMXp(!HL%=Vcb\۹IL)NMmt !'XD9%;"Na1Sɏbs<"=Aފ:BEF+IV\C0uӉnp$ڦ|9Y. Sb1X>Ov=DvbXG8c"W$sK[ h'ZH?ٲ k%Ȯґ뜿9o9|Sh8sI2Hg]mk3\HZ(H\ #QέVeEmc W^rd7gvɂtmm{<hhx-ˋϙ1{mrAsO}>r((wOEA6$砫¨}'D1*磜8f(7K~s,+GB~ q복WnG 厉S_hܘ##= !6rsYYZ&{)ס:M-ɚe>F(%NZc }V凋OSEPQ׽$?햯 &; Y{&p)}Btm8\ dr!2y_Pˀexn:9״}<FdCT8 kȧrF:AzIĭ/꥾/1+Dv8whnild|vG\ \/ōC~LIp<#9Q}|=z'X]ԏA&žch^x~#:6;uc&eq"ʰ:yCVow>3睯8x~|INvc#gc,'qqc>GS?]a'9]&?صz\{,t2O%9_1pDvq?$.;s~/t#7x| _8++Dy&牴4噸ߣ<6> \yA)vz w ?h  Ώ9O'?Dc#= ,;ɤl??Av릱6da|}s+}WdoC9#uи %5Ͻys!Y {jxLE|7I7q͹ѕ} qHua΍zeg ==c%LEmN2"l̰ېnrIvc8.AD]}>4昵I39## &.8G"zVrĴG?GRl]+s*b\ɎŸӞCn?cF^ɎN|?2Qe}~LN1vTW}< qJ8\vѻcNIxs^Nxsp$YsFڥx;|%yM33 nl"Xcx ~6zR躿{_ܖ>ɔ@9/#Rn8,<^˗I\Yϲ{,sn_r {wΚSgIx%s1ߧL/=Bs܎NfY;4tkA86^J)KX4ڦt#ι*ZwgYzɶQdל[yNm!ʛꢘ?8hn c-S>!]#K";EDK}/^'>MDzO+El;x{]Iq|(#yts3ȷY]1M_Gc$=?J-ԎU/#_k{|Ɇ2X_xy^?_st֓9>Cs)zVg \(/MG(_1%a,%{۠|t[$˱ vR1d5,ܔǍ䋨*KsT'ղ]us۲XZ7!%%^ 8Wk=t?|͇[w_s">G'\1ɉm7+7tas݄+kƈk `GG?;W o9%ٻVamTXt?*;uoeiO[?å{-X}2xP]|_޹FUq Z͖ u+Vچ PqC˲ZrI@4OD_OƄD# c|'}Иxa?1\[o633gw{k7$r|։8a}yM]iw3v96RiCE+<19B^K幰74\](&"+r\C[!-_4ISeKMd/ Աujs}oHgE}Fb܅h\? !N/u¼~@\wGo®qxu"^ww=v9цH(Rh'do=D{8soWv |r.{x/2$y_¡^62Y=Vpr [i+?+G|_^?Ju<%ߩI}!O3"{ٟ'CP. ׆~4O AkEh/Ж2ĵAjPm&ǒc~6:i9}IϘCzyuyŚk{C'ɵs&vI/ۋ';Lt0/12̜e LI1Qfyf=q+zL'1 kbP.54QnŒܚX!Q)GBo<(.<0x!9XH7(_W/͆>,FCpi6>|h|_Q˦?B`%^oiyhtht+ :O[QiSc;(((qEQE)v|䃾EQ׊(?(`(((c=B'C{neEQbDcK3Ѿ(R|L((((2~r*˺ka or*ieX0O\n,WP\IM=(cP3rB2zl\N,WPyJz|UAeC@+6@/erOlȲ?pePz~!J;HGpLi(Og'Rh4:<;K%\2O$O&2*=z#{0=z‘¢6?o}_4d (C)J1:A[u>'ii6] a߄ uSEiv[IXU$푈U8Mژ6YᅪnVgE/2fc]m;>s#Wr.C*zW&nQJ^XD<|^ 3ȜCA endstream endobj 71 0 obj 40682 endobj 72 0 obj 115000 endobj 22 0 obj << /Type /Font /Name /TT7 /Encoding /Identity-H /BaseFont /ODLZAF+FZXH1JW--GB1-0 /Subtype /Type0 /DescendantFonts [ 73 0 R ] /ToUnicode 75 0 R >> endobj 73 0 obj << /Type /Font /Subtype /CIDFontType2 /BaseFont /#4F#44#4C#5A#41#46#2B#46#5A#58#48#31#4A#57#2D#2D#47#42#31#2D#30 /CIDSystemInfo << /Ordering(Identity) /Registry(Adobe) /Supplement 4 >> /FontDescriptor 74 0 R /DW 1000 /W [715[1000]743[1000]759[1000]855[1000]890[1000]1050[1000]1052[1000]1131[1000]1254[1000]1321[1000]1346[1000]1847[1000]2021[1000]2038[1000]2092[1000]2233[1000]2289[1000]2319[1000]2393[1000]2581[1000]3002[1000]3169[1000]3514[1000]4226[1000]4413[1000]4599[1000]4622[1000]4852[1000]4870[1000]4945[1000]5940[1000]5941[1000]5986[1000]6080[1000]6165[1000]6255[1000]6401[1000]6402[1000]6428[1000]6430[1000]6947[1000]7710[1000]] >> endobj 75 0 obj << /Length 76 0 R /Filter/FlateDecode >> stream xUK0{"R}I{cR A!!H38)qoc71pF&$§6Kby_87M+Fd_g󕿱܅y/q%ĕc5 lc]cf7o .ܧƇ/\vrDر0vM&)fn^ A;d0Ȭ D͑BbO4 RQn&JhרFJrM fTJI 1ȚJ*')jJK!ľEMG-V dH{*;kCFZٶp@J*5(ZW="Jqi4TJƩR, b˂)H:H5J6[g^TH+^9aJR=C#[W|$Reu3\8h+ST2k50p>?9h80>t`b endstream endobj 76 0 obj 487 endobj 74 0 obj << /Type /FontDescriptor /FontName /#4F#44#4C#5A#41#46#2B#46#5A#58#48#31#4A#57#2D#2D#47#42#31#2D#30 /Flags 4 /FontBBox [ 0 -246 1035 887 ] /StemV 96 /CapHeight 887 /Ascent 887 /Ascent 887 /Descent 246 /ItalicAngle 0 /FontFile2 77 0 R >> endobj 77 0 obj << /Filter /FlateDecode /Length 78 0 R /Length1 79 0 R >> stream xTZٻ7~bLADAX( FQL^IIO&g{b%=d\[ux^ D.. 06xGA% TAjd@ ]Ձ@@AoA@@_@?b7fpИ1#cL0fqҘU1c6ǀb`1 1| )&7Í)HbL1{+/揘1cc^ż++ 7x$xx-xxx  '`,NS`x+.%`9X ր jOOρ_???9{l!bbGN;5vzEKbWn "cQɱXblzlflNXN,?V+5źcbƞ={6b7cbľ@C:BAzB@CAFBFAB&BBAAV@VA@6B@I !)"$ Ɇ!LHC  ZbX!vH-7>!y%U-H3;4:::: :: ::  E@P,4JBP&t+ C"h)T AP- uC=P4 ====  >~~6"````}aC`QѰqɰYyŰeհX Ka0 ˇX9V S´0=]=}Ӱ󰫰{:CX #G\D\q= 7:n\ܔq-[,C!q)q8F\~\Q\y܎8S'nW3qWn݉{$y˸q}kwOOς///opx2<NgL8 χK;jnNx-wÏ__߆߃??ķ%[|~Ǐ?1~z[xT<>_ϋW-IWohhXXXX؀؄!  #h؊"Ĉm bBP"t ‰ =}ۈ{LjzD3+9!"SBׄ^ }& MJ0&aB̄ s',OX1M &'&%p' &I8p.rՄ 7&)Uod[d{dgdd/d@`0d4r rr2rr6r%r r!H2Cld#H Y MH;ҍ!ȝCcȳ[ȇd% kRdRI}' I4:i\҄I&KڜDJL%Iڤ]IǓ'I(iI>&@Eڣ:zơf棖V֠6`D EP E Q"T %GPeCQAuT=# -# z z: ==== =Ih,:M@l4f|t!-EoGWh ڈA;е][{'Fs+[_O诘ΘޘAaIi9ŘeUM-L,I$aR0dLa`b8!#lTbd5F1`L+x0~Lsss s sss%9"}r'G%N<)yYɛdXrR26959+\\\M'w%L>|*l %7cc;b{cb`G`cS+@,MDle`Y|,+n*jl5ւ>N!EU]l1)5-=#  7777 7 7 8KQpٸ\qp8)n;NS 8΂sjq^\ww wwwwww '={Jv)]SzM2'Qx'9x>/—+;rFoNƟB" ] =Q1)ińUNH ɄJ"1}Z9KWKIG''ӳYtazYzE<ݐnOwe13c^Œ2el؜ fg23 IƎ Y:Øؙ+PƑg3gq#VƝ3^g+swRR7R/RR4i4i"i:i&ii>i i%ii#)#IɤR:)C$$ I$)$Izd#9Ii8 ">1DzNzKzGDA %w w%w'& !'!#O"O%"!/ /% "'o"PrIF1d@N'gid&9'ɥ2r&f!;ɻɿOϑ/o/ȯoɟ(())(})()(#)c(((S((3))) ))@ G$RД ¡(Ebh(zJ5BQO RvQQPPNRR\\ܠܦ<4PRS>gl)Gf̨љ2dN˜9+snu2dg"3QLB&%3'fgej2@o{2g}3Ovcgd^1{s60NNͦdSy[۲˳+نlWv {ge?Ȯn~9}ΰ9s&Y(gIβ9[rbsr99I9l1'-'3''Hrss9ޜ`Ξc9r.\̹s#V9Os|FFR;SSPPScS3 ˨[1X**SKe T;IR]}ߩGg穗FSKꟴHZ{ZgZOZ4m,mC3Je d ?#88888ø̸ʸɸèc3^3dg|f|cȍm)KnQѹcs'Nɝ;?warssq\R.+[[=א[kɵ:r]@}rϽ{7qn}ncWr?~bavbvcfedfc`bcN`NaNgf.f.e.gacnf1X&Ĥ0sLYƬ``*iddadfge^d^cb61_0dg~d~aEڱFfVֲ6 ,8 ²TbXAaQ iYye5MV =>K^y ϋ7+o^ނ%yyYy<^0(O'۞y5y@ޡyn={א2uޗy.^~A!(XxdT ,|BbR:fv,ʎcdzIl ˦stv.f \v![–r]v} {70$ 6!#C~G˟??E|ZU|}~u%ߑ_ߓ0pSgȿ7A~SO_v5z븭NJٚպ`Quu PZ88=88s99 9+9k8`I9XN:8,N)q*9*c96\\<4pr^qrqq#ݸ=CQhD ,|"2*Zn,ʍ&pӹ\.Wq\WrA.^1  }Cn=%= ; =3/?o o0o8o2oo&o.o>o)o-o=o3̃xG(lyb6^9iy&Ws}3sǼF3K{7~~{~7~O~o~_P(x "Rj:&>O,>|!_/|-_7|?????*$*!%' */"&!+X(X,X.X%X' @HA Sl e@#  (+8 8,8.8)8#8'CpUp]pSpOPP/x&SY]!l+l/!%(&/!/\"\+ B0Y l!U2yBXX*,ʅJFhz~aPWx@xHxXxLxFx^xIxEx]xO@X |!|#&l.ZثO# GN.\Rpca\!URZSH+d 5šBGpWÅ /^)VxI¯Ez/W4h~"p(U-"QEEUE"sU+hoENJN-TtVѝ'EO^/\CE:Fƈ&ff66".B0""D QH *E%"hH.ҋjDnG.:!:+"#z =}G;3 ċk[P1\ib"s1_\(KvLWb-wOO//o&[{g76ŝ{)R>~#m=}CS3 Ky!OX9^&|yD.oWr$wr//ERPT+l +kۊ:Er)e2OUS%JR(kT*J*UP)TUʧڭګگ:::S=T5^^>#=}#ԣ3Ջk[ 5X k8F)єik4]jvkhNj.jni4ttcuSttt utu X:.EGe:Jt;tZ^guututu.nug׺Ϻo.>A(}~~~~~~~Kj^T//V_3Hoo@4$4$6 @C 7n8pXñ1c5o8qR)S5No8qV9s5o\иqQ%Kg?Oo 4w6ָg3g5oGK4^mxF[4mxAßԦ)mSM:6ujԥkSM=zcu3af0loY/>>p֊HS/hۈ=:0jhYg32kYu\agDDSΊMcsb1ƶ 9+`zbqFQ@08  KBκ  !g ;X**h:~N^!iy%=Cc` O_- 44  YuKY \Y3AT :Ն( 6nY@/[9kװ ;똘1[u]`+geİc Z9-{"κ >VΚSl0\KU`%XrV3 w4l>;k;_Ocvbunec7YZؚX_Y? 9kH? 0HT., ;:BΊBJP!agB!%bԴ8aȩ^܁AC AB#ЎЮ~!aQбIEu#4 Mlql(nqht;j&5䬁ހނޅC_B~~ 9k{X'XFujYVV6b`a$Ɔ0QY0?4:nYÚ``a{ c\׸!g7*n\us4vԐ ᬷMqag _Y7gvn[C;YeUM=x]~ ;k_5nnܰnWk~q}B:111%+@mqV*`""xnGBjB j[9E m8kd+gvuC+gUHߜ/ڿYc!Dt"61-DA($DC#ћHܝx Hⱐ^N0IY?8k 9Pd4rtGAGΊAx$d!9HR,EJHiG:κIjM4%ivҒuI[5_^äI&}L@ 9kT_@X <"Jjf4ɨ8(! UځR4(r֝ӨK #s@A@AO;낰Ƣa$trY$tVYh.ZUGEFC~rgΘnޘA!(̘.,ìhL!b2Cp0L14*;BκssYb0 wɀuDĿ9IvƎĎ;,<*:&,8lZ`bl fl v}!g==>c_`ba?`"p:7 771 pKp+qkppp0 rV2.兜U+ŕ8k5΂\8/.;cΊkNi%GJ!)SB:2S)QJEJUBκ9u֩E5ag5 / ;:g//㯇!mڝ'#c:Y7@_BsVAKr;ag󿝕1}q։!gv֕ĵD`YQD<1H&fsZ7gUD h!ڈ!;GorwvRY'L8uyƤBR1!geYTt7~nqn!g8k/ΚEi4E:. ;k84Ό.9ڰbCeegH2g2T!g p^;Vڎԍԃԇ44444444;IkIH1$( NJ$R[9VTHJI-j"Intt:WB HHHKYu"y*yFYu y#y LFr42L#熝Uvd5YK6ڰ"# 9M=򃐳>o_Cڕғҗ?QQpU-/Z@P )Ŕ8FK9@9WBz 9_uߜ3KY/e|*W_5#+3rւ¬␳Vf)4Yΐڗ{Yo!yv 9kcY ٔ윿9"[7g:=gNYlYs9i9r r9ZՕ s8TV )Eǜ/uu$u uBYQrVtZ7䬧u EƴrY-ΊBʠиsV[+g}Dk}Yu<}}}}}anP:;+V+2&^KMO?B?r֫ag}Do?og7C#ьь !gr֥U[CZgxY32-=Sv9!gr9!g]r֘܄\|njnF.+wk04"WvV8Gag}Κىًٕٟٗ994cC: c&1[4rz[4"pօ嬵,+rVbYsYy,.KY~o嬗v-&Y⬌5~_̯ׄBzo!*.%+ ,'rYag]+ J ؂n(ꐳY 7O!gv 9P萳.;+"!gU$,nq‹ag>/:p^sVVaA0갳ֶ8Y8kFYYEBΪ)2ي\E`YO.Ptfѝ!g}YSYۈ:zuߜuh/ΊkqVguYψ.lqagM3Zu'g=,>v֫:#qS+g]<([9+g=\|B+grVC_Tɥ祝KG(]ɥRfY:L2RK0BYD(Yag=(9*9!9+ $.-'y,i< ;ǐv ;밲 e˦uAْe֕J*⬄r^|GT^S,@c'/_,R~N'M/C $&!+/,&+"#/]$]*]vV.MbCJҤ[)_vZi@;Bz!w {Fr agMHH UP*h[ZR!PUTW8*8r{RYyb;ߪU_5ji U2CTRu 9 "2Jj&Y rdYrV0Jg/]vLvZv.M!grV?u|wtuag}r֯!g8j}z}}/ZH끿KkGiY)'IkS3~jh~y@smsymof53sͳg4OiGۏY?F?ා>|{շ]j4<\zpmLuAu}zuXס.MWo?nkw;|sҙK/tbiΠ? z+ :-h Z)XuAmPTUAePAV 2 5 R ! bAtL &Ax0. A`pKpspSpupepIpQpapAp^pvpVpfpFpzpZpjpBp\pd0*8"8<848$8880?7'#=%1!>.6&|| | | | |xh < < \\ \ \\ 8888|o68@M@y2PJ@Q dH!666V#}=]]ScC}A{~m~u~_W /~_~gi~'iT?я~?ɏ'~ f&jJr2B|zΧi|J'U*};|}>'J|"_Ox<ӗh_/G}>/ Xmmmm-----MMMMEFzzz::::z?߽߼_y{y6yww׽׼ǼG{;AokZګ*۽Ro[-E^zY,o%{I oz1$/ ya^x-u޵ޥ%9Yީ1Qޑ(0o/oWogoGossgz̞jc>>>>>}nvn6u w[.uos o>g>k>c>i>a>n>f>j>b|ȼek6l6z֬1Wwef\b.6 S}X;ՖjsicGVGUT=uks3Scxxxxxxxȸ׸Ǹq1hmFh4Fq(1KbXd,4<#X`32t#͘i$3FgDHca3Bc14n6736240.7.5.4.0140N5N6N03512F#ÍÌC}}=]]6F/{;ß7gFCwA~^n1 5d0AcP*C 5Do8C!4h!ǐm4P t֐`3 PCdXmXienfboinjlh`geianjbhhko__ҟ???߯߫]zFӫ*\_/ӗE"}@ֳ$}z~~~~~~Y'˺#t;u>Wֹt5:ZtJ'ѕJtbHW:.GХtdFmmmm-ԍEFzz:hhkjҾѾ6i׵hijhZ֪h*mMӦjmEkQZnnnnЮ׮Ӯ֮...NNNNvvӶFj5?455454/55O5M'ǚ{ۚk˚ 3Sc5Oո4fRljhjX&GIפiI$ijh6hkVkViVjii&i&jkFkhihzkzizjzhkj:h"oԯկ/շWԗ՗gէէAY-Q 5_Ss,5]MSid5FV jUǨAjzzzzzzzzzzzzzzzzzzz:RF PP}U}Q}RWSzzzzzW=Vթnn.ΫΩΪNNNv<*FeRUt*RUڦ*V UB_U**SEPp* * QT[TUkTKTUTUsUsTT3TTSUSTѪaA~.ΪfGʷ7WG:]uU)Iq1Q!~.oʝ^Qʕ2eRCY(Kb%_UnU+<%KTҕ4%UT4e2ES(eLP”+K3ӕSSccC}ݕ]mw7g&E¯p+\ ¦* BP(d*EB(VOURd*pxD+b@f&F:*B|<\Td$xXEbbbb"R7ȿ?_ʛ''{Ay@;yD^,/ |y-ϑg3$y<]&'r#G˓H9B/P9D[kk+KK ScQA>Ng_FY쑬NvWvKvCvYvAv^v\vDl/s2L.+eɲ8HEYANVRLD6_r]7lj%JvFͲzsw[ƸF+4gGځ $$%$9t$0O{gC {{{gG{d#+~dŏ >H#g<Ň=;_US{gsf:{ͳ78f_6{UΞ?{칳gΞ1ov[f7n]=;>;6bvhvم ffsll6:gYs5i6Nך4B|O7?tǚm~Ϳje}?oY]w6kpl4͙fYn>|yYjN5ojN6_ѼyOm͗7oh^߼5ͫW5l^ڼyays4lnonmni,6ǚ++˛f7fhݴ7~q4BjU/hR_V՗=zW=YOchݭ[32f1Wg/<='gr]3:[gp3y̫ffg3L;s̝383\4s3g9vf|fdfLLd&\y_jߪ}ڗj_}t3j]{}Qߵk\{[-߯{+kjXR{vv6Uvwڝ;jnZvcڵkW.]P;vniSkj;jjkjښXmUm6X멥jZkNͪ>_^g_~T?QHWX W_[lZ}zZNUNVQz[՛/^[zigWOnnTP]_-VWWǪ+ա@&jjU'sǿuǟ:z~wMo<~_s?dz#CɇyhO}{ű'?;c>cQOϗTAoQj/]o˟)Tc取?RpC',_(y.ˏ[o.{ו-#FV-Y|] )]>|jy_yOygyGy{y[rz ^p=9G>z3q=辣J/}J[\gK)}҇KOK+D=w/IKo+^UzeåRT+/)WtWm[J7n,PtyҹJgN/+-.*m/m)m./+V%Y2JڑG~rGw#>#pG>}cG>z#G>t#=R;R=?;=9>:/>>?>8|+_~×~_t>=U:2uxjjWL7u-S7O4uSL]1uKΛ:w̩SN7ujUS#S RS)wʜ2vs>{3>u>~o=uÇ>tC}}{=q;'gɻ&cN2y'o|K'O^=y䅓O=yɭ[&7LN.\:9<98?3=5LM&'ddҝdOo|OO|#/k_W|}PrW _-|³oYVۅ B0SfapaP(   '6N.l)l-l+l/(,*.)-+R8pZ3'7&9g}ߚߟW'Ͽ?Nh?x~?&e_'8/ j/Ă/Hgknryu^Wyu^Wyu^Wyu^Wyu^Wyu^Wyu^W^:K&.Qb͉Ce{h-3!74,.šamrd(j:Epzx($gYYsփžP+4 [rMc?eabClD̟`I-8!T|61B2OНb3ahMӓM'T6:oT}l"nZ fHLm:&rNX?bLcE.?b!WwÅᬿ*Yss}xWka=@Kıi'3kڃx(}Z/>mkݮ:kQ8f[;]Y!Y;s%"$G#('>He'&+y&oPqqml.H8nˋTl3|frM5LwvQ]wCzxN,sT { Ĭuqͯ]gWD34&E]&DO4iݮ6lNZڗ'&v.Г|SגOJyZgI|,ӧg2/ţdX ,+Tdchʵ%X]MNwDžB=  _kCXT%#~E3BL7lTXWɗnӄv E '.3ۄhT"v'oX&GLd-s3&G$Ed,'ЊXjJ-kŲ Ro zEz:;Y&~o"츧OdRn7"wkl]ҶzV{-[o88W6+gĿ'~~>lM@!s', hk ˺G"vquC(}ɑnB5-ѵ6ڜ0oluMSuOjVu=b4sBY1fUM1a[e %Mb}-RnNZ۫|/ua>-:g.Snytp[ܘs#n_BV #fF>3gNq1mgk/L:4xϸ RV.t1LgQ%pD`JFuɵMєef>§ u {u%s-߮4ja /8RSA w"gXWY !˄욭)%̋?G1/rj*=-]p zt:wK_>{ S~^+Ccagm==iΣo9uږuE-¬D9V(dee;r,au#v*g1F2iɴLJf9B0Cp9y˱Rr|$_0GͰ x4ٜRB3| ʎIWZutr8-q_.V/|ޟ^#0Vigy{M"Rli//eKv {ڣiVmmY+}~J̆(N}ܖ;J gu]IN כ<ñ. &YIzjsA]q)㮾bߏ &O<˾']0R3bZK xpN*s-iU膂kV=,덲p ۙ9[#:mcxKX$"ZݚYeS4i)^6%]/ul_LS4-Ф^D>06-O뱐c c~7ƝrcNַjk XU VL1G.t J8O:'sp9;vQjbnZo_*҈gš%TV׮0ԝ{+F7=F]_=;Mf: [Q3 %NκPf)G;%p@49 BH 1{d'xd4q13ZzsEgC-؆\Slpk/S\fn5YO<;g޻RvmM#~Jv)I,Gj 4b @qN3Twŕ|p·¿$ïb,Xy<х.7B! !fCV,V`B9N&50 P/=K&"2t/'!]GCxPs$߰d6 ZjvEyB3a$Yȷ4!qq/%C:ZjUh4y(FN&P`Y`ϲNsaV xV/s(W 0tb˕H \1XLѸkً|K$+`1)H8Gݖi/˙Չ 19Eq3"xe g{`2-vGݐqȸ8 Am]>oaUK'ӆzk¥ՂlZ) ϕO,Q*r3l{m"ҥ1EO|}_hO?'ì*լhz9pN?)'e iV|+ׂ̺̋u s6dLBP^q'qG,×#?pY7y_pB{XhDrMJ[@4'|[b 3Մ!ϲ= q1q]ݲF.X4DǮ$vN z & ȹL*GhiW;CĒ ;ɼ r u*c ĨCZVH:٣ɔN+[S_tшmx#l`bM_kf" XX tT@lKmqW7mݿaCG~}-xq!)T* %/w9%vV B~s9I-ŴS rP 7q nvŅˆ [\UL +hI$trP~FfgYQ˰쾌fsYދ2֭A?A3,Wj[Bo?`&\3 ;r#+{hBtJ:t#|(^̶#ŷbvH'hv@0Z!~($scֽHfK7g$51BBk׳Nf'&obZ9J+g%N9!G2!4V nl-~J-5dWaQn!ߣR;(9ATFj-R.U.fM&Mc _ ֋#377l$.ٗ?as+!J2Zp5g/[ D|%YOe~3#!῟4굅K /rYNDuǬ)Nx3b]l4D7kUn߾@!Ͱ4)b i) \gݯ.uW Yx< '39mubN't:HJ0V#st2>ZBc~Yz.fNdHG鈿W;}1'VgfXn6{]\ʜPlfBY\󃙒fN_(swLLrvhL9؀fc1g0}Yxʋ;Hm KQ44 LX0 [$t6./"-,5q͵NԲm[ V;<҇pKZθ³}V<Rh]챖R9䂲JpX1<f5ېz{ڍ\R $EL3.]#=\d,bݚ#̗fbxF$'eZʲ  ޴#}Fn?5(gˠ&4=,8eɱ\n_YI0/Hr[’&BMp?0b3s@)C2\W@*.pJ%tJSI˱uoc)Mn_&9ύwyш%ɮ|:YJ ߂koiXB ^`P6@o [3(&PIZ݁o S!N-g0Df%Dͺ]Å^™ln\LѼutZhӃ ODR]!ǔg+vX#Z$jtC-dl6ڰShGi!Kтmwå>VNИGh2{8{ϸM&l=b M"@Bq2meC>< 7 u)&(d{C`;晶o֮)K $Rzn$y]U9n6exau8J\r#"0Ș&v1.-+~gOw@iq;Zk>uSiX^zvP|Ղv.UABkߺ%sٔHFj87Q*|@t|dy2cw8k;c\Q+B͝} ?v9q~rBedc5&<9q{ם u՛2.l@ܳS(Mj|؏eo KOX"Xh%;<?вs M3E m`+` M~{&;٦:d0chRXxN 2"$Fhx'26ȶ'%Ng5KraX̥So k1VêT0'#r.6:B+IZLPTBd'fyEƒ4# (rk x4v]a͐FB^x+Fˍn Rj\7Lx_m>FuԷ.vw~P}}k~tnaʷ^%"gK o ODNͲBA~FV.#cPya[j)n%NQ6)'zg7g0#bhfe81|+.m1s[z^(O<3cZJqŝT^7v ZncU3V|w'(%($D\=vWq?,_PD#W彐#th)汷Qu ~s5ʺĵ,#w=/w+ᗕk9~0|*Ͳbϋw97.ڔ7Ż+'{xniN`_>+3)q?˝'>[~8tO|"'Jv-}*[}+{ݪ(8AUWM݊)PBEQ)[g [vBT+x[r~@Й#ԇy˞-WmAwnTHQcvNɰ\vܓ}I#e@8]m[գ Ϻ,3j qX=˾jlwPZjoL_Gu}FSGG\!&>>˹*6UYœSD'GxVj=jH?+%UW[)w٠ZgqzmO~Om,RvtBQGUxW{clgZ/Ÿ́-ä2LeZוٸߐ׭j ԼG](ʪN)~A.ꞬT2|_ϗUrNjRNW1)dI?]d UOԕ^2/GHP<^ڑd1}/dxQsYZI$Q;O氎Vpx[3(ʆU1uR3H'Ƚ3D!sk+B}3ƀu<56Q&b#{/y>[|N:}:7[۱(kp kWx携me!khGH=%-5/k6Qko}mCCY7}Ne:@y qB^ z#ީYo\޶Q5%Ralj;O}Kc^"W)!^uBK를mwSrҗ^Ɖ5xs`ljS y;2=^u[m9m02 R;!‡k{Q ?_2qގI9b[!N^3a~F=ͅfG]`H1G RU)&O&0yNq0l]ԏC7pl@m90a >Xv ίI]&mBFaҸQerx'Wt4Oϑ@[&(sB!HQE<d21yi xGl :\im{Fuz?2۱ aDZN(UmR'u~ƲqradS:񶟑gdE 9ʑzW||  ?'QCoi'1E [O7Fk=$89N}Qu :8Wu?>F ԥ#6[|XC't] )5fN%=ਠρS;c-ϗs'h4Kd}}'X#%d!Cʑ4n%?=C2[)5&/ OZ].40 |:ul`ls3A~[)qR|3͹AQcZ`+ t e ^c?t yJ. c>4f>܂ AE@y"rE Q tobC΂'ؤOkp ƏcA!c4SBq6o/[J1s(m2ry>MC(GP\ [qcw|F=ͫ|K'`$|ј_9S1 ϩ\%H R&y{/4Ob1ςW (Ayj-RrӨKs /v1yۦ.`o*ZJ䤩NB =`8O" _٤$xۇмb#W Fw T9{-eu(͒v(<\!}j(nz1*w1`{w@$x2 ;ZL!'))x$qhx|;s؂ ٠6눳)XsF4oq"&}c#QL9 ֏ ] y|~zh;N֤C|Ƽ07W~ h@{Ktz\Jpݩbl;h 6yC ƹOs8'Lׄ1`1.kiy,h΅'m.a-hG2D:F;d{VA<!5X.+BƸh.6x""dI~)'[Y7V:Ꟁ-hN{<-ӓG)+1Mk m`Z7XK#/3(P-`Fԋ/U V|{^wҘ 4>P?&uIzij bu.K{wI|2ۄI_sO (OJXoEcF__1ݣø<`}o{yIB6>*WA$ݏA|G1FjwQ{|V15:Ik_88M7$E,8%]As5%I:X6yA 9䩰:h.Vco4tm G)֦6?~6:q,=Eۣ9*G a̅/cK!163MRߍFNc-  -W&Pݗ{A. *ڑ&!pV.U c881_x3=,vAG\3|Ǜi4 y'{t6D#Q< >v;ݫgX>! [{ pub2I8gpv~>PLy6+y- Oi>&xF- ?Gh!g𻈕),_]`A&Cc3KYEy;?JrX3}$9h<搶` ;t4@1'u@n;hR! =+ )oy[΁/h|>fH=J4B43Aw %I_^p3Ҽl0C4ƥx/'|:ALG0tߎ hTCgH/n}GyzM|,$c.X'p 9z GτnR/E}'ɰa8c% ۘb9=/8 F8Ch"LQQIt`1Ǖ 4g={(gMpOP Cao zVh~1V%l- Cm A3׈i4!Q{>S59v.,уI#yA}Gcw/=8G 6<*Xwf0| ] c M}n lBX-O|dŔr#"·Ϥt,NbahvRFq:ӢOȽ_(?R{KRDqS ϐw"hgЯC:{ ٠<(^h0i|WL {`#co1XOi Puq ͏Huä/`؋΍И {̴t kxC0O1A&opA6xhTGڡ>1۲ Ee|JaAOo:[#`ς}`< :Q@@Ϻ`oc<`g~ (q㖴̓0e2 cD;?:)GuCÃ4 `;GBMbDCit.])y)ϰT?n}ۣA١2Nςw{2uyI[&`[^lM 4EǺQGyS7XOK9 Ч;x3 ێP,Eq4dvq3{L_g3!/Hq3/AMBm1[WG r=biL1oo1BA;B I,+7dg!Tv(RDBe cIb6||=WDiy{Љ(i|X@>)N bp_!Bq"P6p tS1`>5V 9 +Qg1S|9'4K>p6e}'`0 @fQO[?Bc R}]9 ݴ@}} ![|L4AFuNSo,V$*yE gݤ wioäu+Gߐ BzI^s/oA,F_0.w"&q϶f!ݫLX0@}31 jlԖӿM.٠WbͩTy @^_0oyPs4W|'8F}l44?Qy0)5a"B&;=O_Yv}E=WK ۤ8&0w;ͥ6b `.O]|ef!gԏ bIA&}7>8 B3l0Ob>8?Oq/FK_)ƹ( " BGLC8(ASJ r=(GСBd9Ĵǣ+8=2<Dv,2 HQD-xI~NA|5M<.'Bi.ir$g5?EڗO[AG`c9!S+2~Et;ovs7p6 l>}KIx!%7 ϙ>荊"Z?*:ߛE*@%}03Gm vE{VEhgv('4g俘~(4 N0 +B*og^Hm_Pm@ǂ9Oso-K.퍴 d\>Wyߵݭ.h !ie$2UTNUw-?$ǼRwz&ۀ~Qs]ۿ*,\Y罼ی);k]nRr,iq7of%x] U?o))Gvkx[<:Ϋ:Ϋ:Ϋ/^5s]ҡ$!u7G%-M_?!kuCP:ԡPߣy "?P(zo7.Pe(yq:?uCP:߃vC=)wS:ԡu迊P:ԡuCP:PgPl:O=?wCF 𫡅[:;ԡuCP:ԡuCЯ%kv7AoЯ;tCyZF>롕c-ZUP:ԡuCbluCP:ԡuCtC!?}%|q#^]|h2EŧֵlF]묟mP׆(s6ŧkK[+>cTל/kM&V{Ե~key}~u-ƯyZukԆԵvkWkѾ2u-~-n_z]7q5 l-7oiw]|{_?wu眽;^~Ux.λfؘg|mE{xw]fv `׳kuv]͖ O`7k~t/y@R^\Vq],zG^Fŝ1\<hy/龠_v͘*Gl@<e6iT<&mEsտ:>&|S??Ll/|8nƏ3 endstream endobj 78 0 obj 35599 endobj 79 0 obj 106960 endobj 8 0 obj << /Length 9 0 R /Width 1181 /Height 1772 /BitsPerComponent 8 /ColorSpace /DeviceCMYK /Decode [1 0 1 0 1 0 1 0 ] /Type /XObject /Name /X /Filter/DCTDecode /Subtype /Image >> stream ExifMM*  (12;%7+id%NIKON CORPORATIONNIKON D3S-'-'Adobe Photoshop CS2 Windows2011:07:28 17:46:51 &2:"'0221BVj rz  ,4141410100T    d 2010:10:05 12:19:562010:10:05 12:19:56  ASCII xd*2(:[HHJFIFHH Adobe_CMAdobed            k"?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?.sP52ʌA♓ikQQ^Ѭh%Sq} NRȪnZfί$p&5~lNP`aه_Sk0+3xͶM5TWߑQv7WUr5s(eꑡ8U\΢rru.k~ɚ}FmV߲ߋZ?YnwTmMx=mYXxγdVڽ+V/Ev{Z(ֹE?Dn~Yf~?V7=,>̯ZOQmVhu/ϸ܆8`VWΝԮEWd݁HtD@}rW]exK N6e2pi/IUJ+z6=V2-9ݑFM~FS1]+^U}V,讞@ߗ[2OnۙW'Nl_i6Ӆ&>wV? zgtc)4tsj׍§\}| 5ʹufumUsqsY/2Qv,ɧtxM9[^̵?*Ï[z߯~?O׳}fYh~fWdi3󟕏ZazMgz}Eu/oܺvVGc=lOY;Gf8~o:ν]ӬɩY:aR ԝ߫Yg:mQpȌGi߸~$?I$]P3]Ψ88=euTw&'03s eލNTdžR6]SmnkyzH{9hĨ2=ؕ3U޿Pܛ]Z\ٞju mg/.朐ƺc,K3ճzs4v3OxɋJL6Em!*XZ yn0ٸsrmnnv+ ºO3UV?&=Zz=y?Y]cՏkmǣy;mZ3Nh>tU;gEgUXvv[K즽Ϯv~mm!p.oI=35X5Y/eYQ[7=|K)zmk `F#>}jow%W3dE nve1U`+mt\]9Ķv~gZv&3mlϮ_iWYT澬OF{/ ntϫ ~+NslkuǜV\>G>Ki~OPk:v-tW՘}jmq;ljM,?Y|:gG}@*Ϋ{v]5zn0?;oT0&_*#+.c!s_eMuGWdTQ乬,89u˥9CX+m8~7evzv'@}}A(G쟱z??>z;m,4qz{j/vܞ{C}-۷d7od?G\ )?M# xZ`%ʫ oܪwnMm˿'ZjkuNZxo\"Ac1ѱԟFOke\IjQw4kVce?OEkmcp>5?I\noOEv^|VSXP81nGW~o[~<!p-1(ᵴf2,2ۓ,VWRos<=u_}f_iySמMn 7&\GG}붜[uV0i铉[u~E93_]BLrMgF7Ax!wd _mt?۫wu6ponp>[H~K)5访Cx_cX_~aއڷۛgwwM^umaY]V}`굵]k=Ob[+A?gv}W?d~GE!j+Gvq>>+JsF>X̬ۏCs)Sq6r31kvNUDuUk7tˋf'Qg+bn[ͯm2v=muϵY; Ӳ꿨'7;G~`cɷOgI:[#VCϵc3C1wZ<o]+oռ z 9{]9zzh}jf_Bcܿ֬X꘢Wꙍ^#[هn]Ygzz[X[=*3үʣ}cf1Q~Hok)c>˫gJ#1m\߭cβ21ɧYP`~UOڝUMgwF˃z^n'w?dʛ~ ' VUCFޒc{Bveb6(NϣOh2 uc ٘,%fQ|:*oZ%}X»to5hxRqo+e}2-~i1`cG=َL+?32?Bf^FE5KՁ =Kr³P̬̊nj?W^?^J:/F. ^V{߿dks29O*P#$zV[x'X}Ll9E]_-{I]`4s\Ay џ@]^ =c*.ݘ웪s{uZr~fU?C~*'?Oq>۷~÷}zo hޖV;L,Ə}6~oOOVor?dW:w?hw?^O tvk>HyvWsEc}]#?ZZjl'zynZeωHdݾ8-hNmp Jx8ms{%KIsZxDQc"6;U~>3 v! f ~?2\E͉[7c&Y.}`=3ԣ tB0Yxhx-*nF#(}pdJzEMiXIh}YUtZ1d't3WZ֏ZFT-ZZHy:f-iS^=5"ګ[?!Fzm]/їyE_ł{;eikG% #QQN rm.N ϊd(']=^㦿5HFMfLnUq~#2/mmجtGSA]%$gC#K:w^:s{@$ =ٶf&KIWH=C׻A3n+{^X,mcscccWV=h4[,VkO};=:¡={Q\O#'\nFvH]A}C+=UW\!+M>[6ݾݘzx~kll6S"dtG@46;Ǻ[d43G*?ϥLsPu 9iBcALu2UrB8L ` '(R*XN- i_c] )fv{ڙ, 3ҚͥI> CE}:L1m/Q77f7gK?bݣ.:1MdH![nk8z-sjx`;YGm~IGXp0,{Ɇn4ZֽQ쪛_MMq_ԺUX oKlPg]CmeW3ԮR}+:ƣjwQۗ{\O{mBf=>C-N,~Mfx{,5޳_#?(A͜Nj^Y9Qe MX粠DZss*m 9(J>m.*ּ̜Xr7tߥ'}}`vVUf6'~2=?=i,F ~CN VIe.!]b=[>iv9C7.LmxV5s$99CeOϯw._`~6}!_}>տ?BvO/{43Z\cjVX;G6#T\ƶa.q5mRǦ1Z}ၦOytK+5#tC;ٻ*V_~Se/j<>ɋ,:~K17kڰm%Ëfkj o:u0s--Rc}2riv]feUzWGKǾ.#2ӷ"͸ߝ?/\^7\leعnײ]'&[ɷթe]>5bt\*^EvNKvD9F>'qj-T\=c;q^_z0fFSk3^>^-f\Wّu^Р8FűիvXd K;w"Photoshop 3.08BIMgP t6 8BIM% <߼+~xkk8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIMoSQlS[[\@TX]kcW(|_hO~biZzWvmA~ ghQu dDnullboundsObjcRct1Top longLeftlongBtomlongRghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM wkDʀ[JFIFHH Adobe_CMAdobed            k"?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?.sP52ʌA♓ikQQ^Ѭh%Sq} NRȪnZfί$p&5~lNP`aه_Sk0+3xͶM5TWߑQv7WUr5s(eꑡ8U\΢rru.k~ɚ}FmV߲ߋZ?YnwTmMx=mYXxγdVڽ+V/Ev{Z(ֹE?Dn~Yf~?V7=,>̯ZOQmVhu/ϸ܆8`VWΝԮEWd݁HtD@}rW]exK N6e2pi/IUJ+z6=V2-9ݑFM~FS1]+^U}V,讞@ߗ[2OnۙW'Nl_i6Ӆ&>wV? zgtc)4tsj׍§\}| 5ʹufumUsqsY/2Qv,ɧtxM9[^̵?*Ï[z߯~?O׳}fYh~fWdi3󟕏ZazMgz}Eu/oܺvVGc=lOY;Gf8~o:ν]ӬɩY:aR ԝ߫Yg:mQpȌGi߸~$?I$]P3]Ψ88=euTw&'03s eލNTdžR6]SmnkyzH{9hĨ2=ؕ3U޿Pܛ]Z\ٞju mg/.朐ƺc,K3ճzs4v3OxɋJL6Em!*XZ yn0ٸsrmnnv+ ºO3UV?&=Zz=y?Y]cՏkmǣy;mZ3Nh>tU;gEgUXvv[K즽Ϯv~mm!p.oI=35X5Y/eYQ[7=|K)zmk `F#>}jow%W3dE nve1U`+mt\]9Ķv~gZv&3mlϮ_iWYT澬OF{/ ntϫ ~+NslkuǜV\>G>Ki~OPk:v-tW՘}jmq;ljM,?Y|:gG}@*Ϋ{v]5zn0?;oT0&_*#+.c!s_eMuGWdTQ乬,89u˥9CX+m8~7evzv'@}}A(G쟱z??>z;m,4qz{j/vܞ{C}-۷d7od?G\ )?M# xZ`%ʫ oܪwnMm˿'ZjkuNZxo\"Ac1ѱԟFOke\IjQw4kVce?OEkmcp>5?I\noOEv^|VSXP81nGW~o[~<!p-1(ᵴf2,2ۓ,VWRos<=u_}f_iySמMn 7&\GG}붜[uV0i铉[u~E93_]BLrMgF7Ax!wd _mt?۫wu6ponp>[H~K)5访Cx_cX_~aއڷۛgwwM^umaY]V}`굵]k=Ob[+A?gv}W?d~GE!j+Gvq>>+JsF>X̬ۏCs)Sq6r31kvNUDuUk7tˋf'Qg+bn[ͯm2v=muϵY; Ӳ꿨'7;G~`cɷOgI:[#VCϵc3C1wZ<o]+oռ z 9{]9zzh}jf_Bcܿ֬X꘢Wꙍ^#[هn]Ygzz[X[=*3үʣ}cf1Q~Hok)c>˫gJ#1m\߭cβ21ɧYP`~UOڝUMgwF˃z^n'w?dʛ~ ' VUCFޒc{Bveb6(NϣOh2 uc ٘,%fQ|:*oZ%}X»to5hxRqo+e}2-~i1`cG=َL+?32?Bf^FE5KՁ =Kr³P̬̊nj?W^?^J:/F. ^V{߿dks29O*P#$zV[x'X}Ll9E]_-{I]`4s\Ay џ@]^ =c*.ݘ웪s{uZr~fU?C~*'?Oq>۷~÷}zo hޖV;L,Ə}6~oOOVor?dW:w?hw?^O tvk>HyvWsEc}]#?ZZjl'zynZeωHdݾ8-hNmp Jx8ms{%KIsZxDQc"6;U~>3 v! f ~?2\E͉[7c&Y.}`=3ԣ tB0Yxhx-*nF#(}pdJzEMiXIh}YUtZ1d't3WZ֏ZFT-ZZHy:f-iS^=5"ګ[?!Fzm]/їyE_ł{;eikG% #QQN rm.N ϊd(']=^㦿5HFMfLnUq~#2/mmجtGSA]%$gC#K:w^:s{@$ =ٶf&KIWH=C׻A3n+{^X,mcscccWV=h4[,VkO};=:¡={Q\O#'\nFvH]A}C+=UW\!+M>[6ݾݘzx~kll6S"dtG@46;Ǻ[d43G*?ϥLsPu 9iBcALu2UrB8L ` '(R*XN- i_c] )fv{ڙ, 3ҚͥI> CE}:L1m/Q77f7gK?bݣ.:1MdH![nk8z-sjx`;YGm~IGXp0,{Ɇn4ZֽQ쪛_MMq_ԺUX oKlPg]CmeW3ԮR}+:ƣjwQۗ{\O{mBf=>C-N,~Mfx{,5޳_#?(A͜Nj^Y9Qe MX粠DZss*m 9(J>m.*ּ̜Xr7tߥ'}}`vVUf6'~2=?=i,F ~CN VIe.!]b=[>iv9C7.LmxV5s$99CeOϯw._`~6}!_}>տ?BvO/{43Z\cjVX;G6#T\ƶa.q5mRǦ1Z}ၦOytK+5#tC;ٻ*V_~Se/j<>ɋ,:~K17kڰm%Ëfkj o:u0s--Rc}2riv]feUzWGKǾ.#2ӷ"͸ߝ?/\^7\leعnײ]'&[ɷթe]>5bt\*^EvNKvD9F>'qj-T\=c;q^_z0fFSk3^>^-f\Wّu^Р8FűիvXd K;w8BIM!UAdobe PhotoshopAdobe Photoshop CS28BIMDRhttp://ns.adobe.com/xap/1.0/ 1 2 3000000/10000 3000000/10000 2 NIKON CORPORATION NIKON D3S 256,257,258,259,262,274,277,284,530,531,282,283,296,301,318,319,529,532,306,270,271,272,305,315,33432;D8C2CAB089780C7F33D0FED82EFF4DE3 2011-07-28T17:46:51+08:00 Adobe Photoshop CS2 Windows 2010-10-05T12:19:56+08:00 2011-07-28T17:46:51+08:00 image/jpeg 0221 0100 -1 1 2 3 0 4/1 1181 1772 2010-10-05T12:19:56+08:00 2010-10-05T12:19:56+08:00 10/3200 100/10 1 500 0/6 30/10 3 0 False 0 0 False False 700/10 2 3 1 0 1 0 120/100 84 0 1 0 0 0 0 2.2.0.0 36864,40960,40961,37121,37122,40962,40963,37510,40964,36867,36868,33434,33437,34850,34852,34855,34856,37377,37378,37379,37380,37381,37382,37383,37384,37385,37386,37396,41483,41484,41486,41487,41488,41492,41493,41495,41728,41729,41730,41985,41986,41987,41988,41989,41990,41991,41992,41993,41994,41995,41996,42016,0,2,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,20,22,23,24,25,26,27,28,30;C6B5FC2FF7F46BBA8271B6AF7387EBF0 uuid:C5BEA958FDB8E011BAB0A959FB449350 uuid:0022A4F9FDB8E011BAB0A959FB449350 4 SWOP (Newsprint), 30%, GCR, 中 }ICC_PROFILE ADBEprtrCMYKLab acspAPPLnone,ADBE A2B0@A2B1@A2B2@B2A0 HqHB2A1 HqHB2A2 HqHcprt2desc<gamt {wtptAS00 $textCopyright 2010 Adobe Systems IncorporateddescSWOP (Newsprint), 30%, GCR, SWOP (Newsprint), 30%, GCR, N-XYZ ,mft2  !"#$%"&$',(0)6*8+>,B-H.L/T0X1^2d3j4p5v6x789:;<=>?@ABCDEGH IJK(L2M>NLOXPfQvRSTUVWXYZ[\^_`&a6bHc\dnefghijlmn4oDpZqlr~stuvwxz{|.}F~^vل-Kgݎ'=Uiߚ'Os=_3]߰3Sն#GqݾKcÓ1iɡaΛ EuԷ1}+܃A=AkQsiOMIEc)'KofN4  nVD,|fT@*  !"#$%&'(t)f*T+D,4-&./ /0123456789:;zf?^@ZARBLC@D:E0F*G"HIJKLM NOOPQRSTUVWXYZ[\]^_abc defgh i&j,k0l6mf?^@ZARBLC@D:E0F*G"HIJKLM NOOPQRSTUVWXYZ[\]^_abc defgh i&j,k0l6mf?^@ZARBLC@D:E0F*G"HIJKLM NOOPQRSTUVWXYZ[\]^_abc defgh i&j,k0l6m.o_O>.~n^N>.~n^N>.~n^N>.}m]M=-}m]M=-}m]M=-~~~~~}m]M=-~~~~~|l\L=-~~~~~|l\L=-~~~~~|l\L=-{k[L<, zk[K<, zjZK;, zjZK;, yiZJ;+ xiYJ:+ xhYJ:+ xhYJ:+ whXI:* whXI:* wgXI9* wgXI9* vgXH9* vgXH9* vgXH9* ufWH9) ufWG8) teVG8) teVG8( sdUF7( sdUF7( rdUF7( rcTE6( rcTE6( qbTE6' qbSD6' qbSD6' qbSD6' paSD5' paSD5' paSD5' ~oaRD5& }o`RC5& }n`QC4& |n_QB4% |m_PB3% |m_PB3% {m^PA3% zl^OA3$ zl^OA3$ zk]OA2$ zk]OA2$ yk]N@2$ yk]N@2$ yk]N@2$ xj\N@2# xj\N@2# xj\N@2# ~~~~~wi[M?1# vhZL>1# vhZL>1# vhZL>0" ugYK>0" tgYK=/" tgYK=/" tfXJ=/! tfXJ=/! seXJ</! seXJ</! reWJ<.! reWJ<.! reWJ<.! reWJ<.! rdWI;.  ~~~~~qdVI;. ~pcVH;- }pbUH:-}pbUH:-|obTG:,|naTG9,|naTG9,{naSF9,{naSF9,zm`SF9+zm`SF9+zl_RE8+zl_RE8+zl_RE8+zl_RE8+yl_RE8+~~~~~xk^QD7*wj^QD7*wj]PC6*wj]PC6*vi\PC6)ui\OB6)ui\OB6)uh[NB5(uh[NB5(uh[NB5(tg[NA5(tg[NA5(tg[NA5(sgZMA4(sgZMA4(sgZMA4(~~~~~rfYM@4'~reYL@3'}qeXL?3'}pdXK?3&}pdXK?3&|pcWK>2&|pcWK>2&{ocVJ>2%{ocVJ>2%znbVJ=1%znbVJ=1%znbVJ=1%zmaUI=1% zmaUI=1% zmaUI=1% zmaUI=1% }}}~y~m~a~U~I~<0$ xl`TH<0$ wk_SG<0$ wk_SG<0$ vk_SG;/# vk_SG;/# vj^RF;/# vj^RF;/# ui]RF:.# ui]RF:.# th]QE:." th]QE:." th]QE:." th]QE:." sh\PE9-" sh\PE9-" }}}~s~h~\~P~E~9-" ~sg[PD9-! }rf[OD8-! }rf[OD8-! }qfZOC8,! }qfZOC8,! |peYNC7,  |peYNC7,  {pdYMB7+  {pdYMB7+  zocXMB6+  zocXMB6+  zocXMB6+  zocXMB6+  zocXMB6+  yncWLA6* }}}y~n~c~W~L~A~6* xmbWL@5* xmbWL@5* xlaVK@5* xlaVK@5* wlaVJ?4) wlaVJ?4) vk`UJ?4) vk`UJ?4) uj_TI>3( uj_TI>3( uj_TI>3( uj_TI>3( ti^TI>3( ti^TI>3( ti^TI>3( |||t}i}^}T}I~>~3~(~ ti^TI>3( ~si^SH=2' ~si^SH=2' }sh]RG=2' }rg\RG<1' }rg\RG<1' }rg\RG<1' |qf\QF<1& |qf\QF<1& |qf\QF<1& {pf[PF;0& {pf[PF;0& {pf[PF;0& {pf[PF;0& zoeZPE;0% ||{|p}f}[}P}F~;~0~&~ {pf[PF;0& zoeZPE;0% zoeZPE;0% yndYOD:/% yndYOD:/% xncYND9/% xncYND9/% wmbXNC9.$wmbXNC9.$wmbXNC9.$wmbXNC9.$vlbWMC8.$vlbWMC8.$vlbWMC8.$vlbWMC8.$||w|m}b}X}N}C~9~.~$~wmbXNC9.$vlbWMC8.$vlbWMC8.$ukaWLB8.#ukaWLB8.#uj`VLA7-#uj`VLA7-#uj`VLA7-#~tj_UKA7-"~tj_UKA7-"~tj_UKA7-"}si_TJ@6,"}si_TJ@6,"}si_TJ@6,"}si_TJ@6,"|||r|h}^}T}J}@~6~,~"~|rh^TJ@6,"{qg]SI?5+!{qg]SI?5+!zpf\RH>5+!zpf\RH>5+!yoe\RH>4*  yoe\RH>4*  yoe\RH>4*  xne[QG=3*  xne[QG=3*  xne[QG=3*  xne[QG=3*  wmdZPF=3) wmdZPF=3) wmdZPF=3) }|}|}|~}~}~}~}~~r~~b~Q~A0 |||}}}}~r~a~Q~@0{{||||}}q}a~P~@~0~zz{{{|||q}`}P}@~/~yyzz{{{|p|`}O}?}/~~yyzz{{{|p|`}O}?}/~~xxyyzz{{o|_|O}?}/~~wxxyyzz{o{_|O|>}.}~vwwxxyy~zn{^{N|>|.}}~vwwxxyy~zn{^{N|>|.}}~uvvwxxy~ynz^{N{>|.}}~uvvwxxy~ynz^{N{>|.}}~tuuvwwx~ynz^zN{>|.|}~tuuvwwx}ymz]zM{=|-|}~tuuvwwx}ymz]zM{=|-|}~sttuvww}xmy]zM{={-|}~|||}}}}}~m~]~M~=-|l\L=-{l\L<-{k[L<, zk[K<, ~~~~~zjZK;, ~~~~~yiZJ;+ }}}~~~~y~i~ZJ;+ |||}}}}x~i~Y~J~:+ |||}}}}x~h~Y~J~:+ {{||||}x}h}Y~J~:~+~ {{||||}x}h}Y~J~:~+~ zz{{{||w|h}X}I}:~*~ zz{{{||w|h}X}I}:~*~ zz{{{||w|h}X}I}:~*~ yyzz{{{w|g|X}I}9}*~~ {{||||}v}g}X~H~9~*~ ufWH9) ufWG8) ufWG8) teVG8) teVG8( sdUF7( rdUF7( rdUF7( rcTE6( rcTE6( qbTE6' qbTE6' qbTE6' qbTE6' qbSD6' {{||||}p}a}S~D~5~'~ ~oaRD5& }ICC_PROFILE}o`RC5& }n`QC4& }n`QC4& |n_QB4% |m_PB3% |m_PB3% {m^PA3% zl^OA3$ zl^OA3$ zl^OA3$ zk]OA2$ zk]OA2$ zk]OA2$ yk]N@2$ {{||||x}j}\}N~@~2~#~ xj[M?1# xj[M?1# wi[M?1# vhZL>1# vhZL>0" vhZL>0" ugYK>0" tgYK=/" tgYK=/" tfXJ=/! tfXJ=/! tfXJ=/! seXJ</! seXJ</! seXJ</! {{||||r}e}W}J~<~.~!~ rdWI;.  qdVI;. ~pcVH;- ~pcVH;- }pbUH:-|obTG:,|obTG:,|naTG9,|naTG9,{naSF9,{naSF9,{naSF9,zm`SF9+zm`SF9+zm`SF9+zz{{{z|l|_|R}E}8}+~~yl_RE8+xk^QD7*wj^QD7*wj^QD7*wj]PC6*vi\PC6)vi\PC6)ui\OB6)ui\OB6)uh[NB5(uh[NB5(uh[NB5(tg[NA5(tg[NA5(tg[NA5(zz{{{s|g|Z|M}A}4}(~~rfYM@4'rfYM@4'~reYL@3'}qeXL?3'}pdXK?3&}pdXK?3&|pcWK>2&|pcWK>2&{ocVJ>2%{ocVJ>2%{ocVJ>2%znbVJ=1%znbVJ=1%znbVJ=1%znbVJ=1%zz{{z{m|a|U|I}=}1}%~~ ymaUI<0$ xl`TH<0$ xl`TH<0$ wk_SG<0$ vk_SG;/# vk_SG;/# vj^RF;/# vj^RF;/# ui]RF:.# ui]RF:.# ui]RF:.# th]QE:." th]QE:." th]QE:." th]QE:." yyzzs{h{\{P|E|9}-}"}~ ~~~~s~h\PE9-" ~sg[PD9-! }rf[OD8-! }qfZOC8,! }qfZOC8,! |peYNC7,  |peYNC7,  {pdYMB7+  {pdYMB7+  {pdYMB7+  zocXMB6+  zocXMB6+  zocXMB6+  zocXMB6+  yncWLA6* yyzyzn{c{W{L|A|6}*}}~ ~~~y~n~cWLA6* xmbWL@5* xlaVK@5* xlaVK@5* wlaVJ?4) vk`UJ?4) vk`UJ?4) uj_TI>3( uj_TI>3( uj_TI>3( ti^TI>3( ti^TI>3( ti^TI>3( ti^TI>3( ~si^SH=2' yyztzi{^{T{I|>|3}(}}~ }}~}s~i~^~S~H~=~2' }sh]RG=2' }sh]RG=2' }rg\RG<1' }rg\RG<1' |qf\QF<1& |qf\QF<1& {pf[PF;0& {pf[PF;0& {pf[PF;0& zoeZPE;0% zoeZPE;0% zoeZPE;0% zoeZPE;0% yndYOD:/% yyzzoze{Z{P{E|;|0}%}}~ }}z}o~e~Z~P~E~;~0% yndYOD:/% xncYND9/% xncYND9/% wmbXNC9.$wmbXNC9.$vlbWMC8.$vlbWMC8.$ukaWLB8.#ukaWLB8.#ukaWLB8.#ukaWLB8.#uj`VLA7-#uj`VLA7-#uj`VLA7-#xxvylybzWzM{C{8|.|$}}~}}u}k~a~W~L~B~8~.#uj`VLA7-#uj`VLA7-#~tj_UKA7-"}si_TJ@6,"}si_TJ@6,"}si_TJ@6,"|rh^TJ@6,"|rh^TJ@6,"{qg]SI?5+!{qg]SI?5+!{qg]SI?5+!{qg]SI?5+!zpf\RH>5+!zpf\RH>5+!x}xsyiy_zTzJ{@{6|,|"}}~|||r|h}^}T}J}@~6~,~"~{qg]SI?5+!{qg]SI?5+!zpf\RH>5+!zpf\RH>5+!yoe\RH>4*  yoe\RH>4*  xne[QG=3*  xne[QG=3*  xne[QG=3*  wmdZPF=3) wmdZPF=3) wmdZPF=3) wmdZPF=3) vmcYPF<2) xwxmydyZzPzF{={3|)|}} ~|v|m|c}Y}P}F}<~2~)~~ ulbXOE;2( ulbXOE;2( ~tkaXND;1( ~tkaXND;1( }sj`WMD:1' }sj`WMD:1' |si`VMC:0' |si`VMC:0' |si`VMC:0' |si`VMC:0' {rh_ULC90& {rh_ULC90& {rh_ULC90& {rh_ULC90& {x{x|y|y|z|z}{~}{n}|^~|N~}>~}.~~~zz{{{||}|m}]}M}=~-~~xxyyzz{}{m|]|M}=}-~~wxxyyzz|{l{\|L|=}-}~vwwxxyy{zl{\{L|<|-}}uvvwxxy{ykz[{L{<|,}} ~tuuvwwxzykz[zK{<|,|} ~tuuvwwxzykz[zK{<|,|} ~sttuvwwzxjyZzKz;{,|} ~rsttuvwyxixZyJz;{+|| ~qrsttuvywixZyJz;z+{| ~qrsttuvxwixYyJz:z+{| ~pqrstuvxviwYxJy:z+{| ~pqrstuvxviwYxJy:z+{| ~pqrstuvxvhwYxJy:z+{| ~opqrstuxvhwYxJy:z+{| ~wxxyyzzx{h{Y|J|:}+}~ ~~~~~whXI:* ~~~~~wgXI9* }}}~~~~v~g~XH9* |||}}}}u~f~W~H~9) {{||||}u}f}W~G~8~)~ zz{{{||t|e}V}G}8~)~~ yyzz{{{t|e|V}G}8}(~~ yyzz{{{t|e|V}G}8}(~~ xxyyzz{s{d|U|F}7}(~~ wxxyyzzs{d{U|F|7}(}~ wxxyyzzr{d{U|F|7}(}~ vwwxxyyrzd{U{F|7|(}} vwwxxyyrzd{U{F|7|(}} vwwxxyyrzc{T{E|6|(}} uvvwxxyryczT{E{6|(}} wxxyyzzr{c{T|E|6}(}~ ~~~~~qbTE6' qbSD6' paSD5' ~oaRD5& }o`RC5& }n`QC4& }n`QC4& |n_QB4% ~~~~~|m_PB3% }}}~~~|~m~_~PB3% }}}~~~{~m~^~PA3% }}}~~~{~m~^~PA3% |||}}}{}m~^~P~A~3% |||}}}{}m~^~P~A~3% {{||||z}l}^}O~A~3~$~ wxxyyzzzl{^{O|A|3}$}~ }}}~~~z~k~]~OA2$ yk]N@2$ xj\N@2# xj[M?1# wi[M?1# wi[M?1# vhZL>1# vhZL>0" vhZL>0" ugYK>0" ugYK>0" tgYK=/" tgYK=/" tgYK=/" tgYK=/" wxxyyztzf{X{J|=|/}!}~ }}}~~~s~e~X~J</! reWJ<.! rdWI;.  rdWI;.  qdVI;. ~pcVH;- }pbUH:-}pbUH:-|obTG:,|obTG:,|naTG9,|naTG9,|naTG9,|naTG9,{naSF9,wxxyy{znza{S{F|9|,}}~|||}}z}m}`~S~F~9~+zl_RE8+yl_RE8+xk^QD7*xk^QD7*wj^QD7*wj]PC6*wj]PC6*vi\PC6)vi\PC6)ui\OB6)ui\OB6)ui\OB6)ui\OB6)uh[NB5(vwwxxuyhy[zN{B{5|(|}~|||}}t}g}[~N~A~5~(sgZMA4(rfYM@4'rfYM@4'~reYL@3'}qeXL?3'}qeXL?3'}pdXK?3&}pdXK?3&|pcWK>2&|pcWK>2&{ocVJ>2%{ocVJ>2%{ocVJ>2%{ocVJ>2%vwwxzxnybyVzJ{={1|%|}~{{||z|n|b}V}J}=~1~%~~zmaUI=1% ymaUI<0$ xl`TH<0$ xl`TH<0$ wk_SG<0$ vk_SG;/# vk_SG;/# vj^RF;/# vj^RF;/# vj^RF;/# ui]RF:.# ui]RF:.# ui]RF:.# th}ICC_PROFILE]QE:." vwwxtxhy]yQzE{:{.|"|} ~{{||t|h|]}Q}E}:~.~"~~ sh\PE9-" ~sg[PD9-! }rf[OD8-! }rf[OD8-! }qfZOC8,! }qfZOC8,! |peYNC7,  |peYNC7,  {pdYMB7+  {pdYMB7+  zocXMB6+  zocXMB6+  zocXMB6+  zocXMB6+  vwwzxoxcyXyMzB{6{+| |} ~{{|y|n|c|W}L}A}6~*~~~ xmbWL@5* xmbWL@5* xlaVK@5* wlaVJ?4) wlaVJ?4) vk`UJ?4) vk`UJ?4) uj_TI>3( uj_TI>3( uj_TI>3( ti^TI>3( ti^TI>3( ti^TI>3( ~si^SH=2' uvvtwix^xTyIy>z3{({|} ~zz~{s{i{^|S|H|=}2}'}~~ ~si^SH=2' }sh]RG=2' }rg\RG<1' }rg\RG<1' |qf\QF<1& {pf[PF;0& {pf[PF;0& {pf[PF;0& zoeZPE;0% zoeZPE;0% zoeZPE;0% yndYOD:/% yndYOD:/% yndYOD:/% uvzvowexZxPyEy;z0{%{|} ~zzy{n{d{Y|O|D|:}/}%}~~ ~~x~n~c~YND9/% xncYND9/% wmbXNC9.$vlbWMC8.$vlbWMC8.$ukaWLB8.#ukaWLB8.#uj`VLA7-#uj`VLA7-#uj`VLA7-#~tj_UKA7-"~tj_UKA7-"~tj_UKA7-"~tj_UKA7-"uvuvjw`xVxLyAy7z-{#{|}~yyuzjz`{V{L{A|7|-}#}}~}~}t}j~_~U~K~A~7~-"}si_TJ@6,"}si_TJ@6,"|rh^TJ@6,"{qg]SI?5+!{qg]SI?5+!{qg]SI?5+!zpf\RH>5+!zpf\RH>5+!yoe\RH>4*  yoe\RH>4*  yoe\RH>4*  yoe\RH>4*  xne[QG=3*  u{vqvgw]xSxIy?y5z+{!{|}~yzypzfz\{R{H{>|5|+}!}}~}y}o}e~\~R~H~>~4~*  yoe\RH>4*  xne[QG=3*  wmdZPF=3) wmdZPF=3) vmcYPF<2) vmcYPF<2) vmcYPF<2) ulbXOE;2( ulbXOE;2( ulbXOE;2( ~tkaXND;1( ~tkaXND;1( ~tkaXND;1( uwvmvdwZxPxFy=y3z){{| }~yvymzczY{P{F{<|2|)}}} ~|u|l|b}X}O}E};~2~(~~ ulbXOE;2( ~tkaXND;1( ~tkaXND;1( }sj`WMD:1' }sj`WMD:1' |si`VMC:0' |si`VMC:0' {rh_ULC90& {rh_ULC90& {rh_ULC90& {rh_ULC90& zqg^UKB9/& zqg^UKB9/& {truhu_vUwLwCx9y0z&z{| }~zxqxgy^yUzKzB{9{/|&|}} ~z|q|g|^}U}K}B}9~/~&~~ ypf]TKA8/% xof\SJA7.% xof\SJA7.% wne[RI@7.$ wne[RI@7.$ vmd[RH?6-$ vmd[RH?6-$ vmd[RH?6-$ ulcZQH?6,# ulcZQH?6,# ulcZQH?6,# ulcZQH?6,# ulcZQH?6,# xtxuyuyvzwzw{xy{yi|zZ|zJ}{;}|+~|~} ~w{x{x|y|y|z|z}x{}i{}Y|~J|~:}~+}~~ vwwxxyyxzh{Y{J|:|+}} tuuvwwxwyhzXzI{:|*|} ~stuuvwwwxgyXzIz9{*|} ~rsttuvwvxgxXyHz9{*|| ~qrsttuvuwfxWyHz9z){| ~pqrstuvuvfwWxHy9z){| ~opqrstuuvfwWxGy8z){| ~nopqrsttuevVwGx8y)z{ ~nopqrsttuevVwGx8y)z{ ~mnopqrttuevVwGx8y(z{ ~lmnoqrstteuVvGw8y(z{ }lmnoqrsstduUvFw7y(z{ }lmnoqrsstduUvFw7y(z{ }klmopqrssduUvFw7x(y{ }~t~u~u~v~wwxsydzUzF{7|(|} ~|z|z|{}{}{}|}|r~|d~}U~}F~}7~(~~ {{||||}r}c}T~E~6~(~ zz{{{||q|b}T}E}6~'~ yyzz{{{q|b|S}D}6}'~~ xxyyzz{p{a|S|D}5}'}~ wxxyyz~zo{a{R|D|5}&}~ vwwxxy~yoza{R{D|5|&}} uvvwxx}yoy`zR{C{5|&}} tuuvww}xny`zQzC{4|&|} tuuvww}xny`zQzC{4|&|} sttuvw|wnx_yQzBz4{%|} ~rsttuv|wnx_xQyBz4{%|| ~rsttuv|wnx_xQyBz4{%|| ~rsttuv|wmx_xPyBz3{%|| ~qrsttu|vmw_xPyBz3z%{| ~stuuvw|wmx_yPzBz3{%|} ~zz{{{|{|m|^}P}A}3~%~ zl^OA3$ zk]OA2$ yk]N@2$ ~~~~~xj\N@2# }}}~~~x~j~\~N@2# |||}}}x}j~[~M~?~1# {{||||w}i}[}M~?~1~#~ zz{{{|w|i|[}M}?}1~#~~ zz{{{|v|h|Z}L}>}1~#~~ yyzz{{v{h|Z|L}>}1}#~~ xxyyzzv{h{Z|L|>}0}"~~ xxyyzzv{h{Z|L|>}0}"~~ xxyyzzv{h{Z|L|>}0}"~~ wxxyyzuzg{Y{K|>|0}"}~ stuuvwuwgxYyKz>z0{"|} ~zz{{{|t|g|Y}K}=}/~"~~ tfXJ=/! seXJ</! seXJ</! reWJ<.! rdWI;.  qdVI;. qdVI;. ~pcVH;- ~pcVH;- }pbUH:-~~~~~}pbUH:-~~~~~}pbUH:-~~~~~|obTG:,}}}~~|~o~b~T~G:,stuuv|wowbxTyGz:z,{|}~yyzz{|{n{a|T|G}9},}~~{naSF9,zm`SF9+zl_RE8+zl_RE8+yl_RE8+xk^QD7*xk^QD7*wj^QD7*wj^QD7*wj]PC6*wj]PC6*vi\PC6)vi\PC6)vi\PC6)stuuvvwiw\xPyCz6z){|}yyzz{u{i{\|O|B}6})}~~~~~~~uh[NB5(tg[NA5(sgZMA4(sgZMA4(rfYM@4'~reYL@3'~reYL@3'}qeXL?3'}qeXL?3'}pdXK?3&}pdXK?3&}pdXK?3&|pcWK>2&|pcWK>2&stuu|vpwcwWxKy>z2z&{|}xxyy{zozc{V{J|>|2}%}~~~~~~z~nbVJ=1%znbVJ=1%zmaUI=1% ymaUI<0$ xl`TH<0$ xl`TH<0$ wk_SG<0$ wk_SG<0$ vk_SG;/# vk_SG;/# vj^RF;/# vj^RF;/# vj^RF;/# vj^RF;/# rsttvujv^wRxFx;y/z#{| }xxyyuziz]{R{F|:|.}#}~ ~}}}~t~h~]~Q~E~:." sh\PE9-" sh\PE9-" ~sg[PD9-! }rf[OD8-! }rf[OD8-! }qfZOC8,! }qfZOC8,! |peYNC7,  |peYNC7,  {pdYMB7+  {pdYMB7+  {pdYMB7+  {pdYMB7+  rst{tpudvYwMxBx7y+z {| }wxxzyoyczXzM{B{6|+| }} ~|||y}n}c}W}L~A~6~*~ yncWLA6* xmbWL@5* xlaVK@5* xlaVK@5* wlaVJ?4) vk`UJ?4) vk`UJ?4) uj_TI>3( uj_TI>3( uj_TI>3( uj_TI>3( ti^TI>3( ti^TI>3( rstutju_vTwIx>x3y(z{| ~wxxtyiy^zTzI{>{3|(|}} ~||~|s}i}^}S}H~=~2~'~ }sh]RG=2' }sh]RG=2' }rg\RG<1' |qf\QF<1& |qf\QF<1& {pf[PF;0& {pf[PF;0& zoeZPE;0% zoeZPE;0% zoeZPE;0% yndYOD:/% yndYOD:/% yndYOD:/% rsztoteuZvPwEx;x0y%z{| ~vwywnxdxYyOyDz:{/{%||} ~{{x|n|c|Y|N}D}9}/~%~~ xncYND9/% wmbXNC9.$vlbWMC8.$vlbWMC8.$ukaWLB8.#ukaWLB8.#uj`VLA7-#uj`VLA7-#~tj_UKA7-"~tj_UKA7-"~tj_UKA7-"~tj_UKA7-"}si_TJ@6,"rsutjt`uVvLwAx7x-y#z{|~v~wtwjx_xUyKyAz7{-{"||}z}zs{i{_{T|J|@|6},}"}~~~}~s~i~_~TJ@6,"|rh^TJ@6,"{qg]SI?5+!{qg]SI?5+!zpf\RH>5+!zpf\RH>5+!yoe\RH>4*  yoe\RH>4*  xne[QG=3*  xne[QG=3*  xne[QG=3*  xne[QG=3*  wmdZPF=3) qzrpsft\tRuHv>w5x+y!zz|~vywowex\xRyHy>z4{*{ || }zxzn{e{[{Q|G|=|3}*} }~ ~w~m~d~Z~PF=3) wmdZPF=3) vmcYPF<2) ulbXOE;2( ulbXOE;2( ~tkaXND;1( ~tkaXND;1( ~tkaXND;1( }sj`WMD:1' }sj`WMD:1'}ICC_PROFILE }sj`WMD:1' |si`VMC:0' |si`VMC:0' qurlsbtXtOuEv;w2x(yz{ |~~utvkvawXxNxDy;y1z({{| }~ytykzazX{N{D{;|1|(}}} ~}}s}j}`~W~M~D~:~1~' |si`VMC:0' |si`VMC:0' {rh_ULC90& zqg^UKB9/& zqg^UKB9/& ypf]TKA8/% ypf]TKA8/% ypf]TKA8/% xof\SJA7.% xof\SJA7.% xof\SJA7.% xof\SJA7.% {qrrhs_tUtLuCv9w0x&yz{ |~{urvhv_wUxLxCy9y0z&{{| }zyqygz^zU{K{B{9|/|&}}} ~y}p}f}]~T~K~A~8~/~% xof\SJA7.% xof\SJA7.% wne[RI@7.$ wne[RI@7.$ vmd[RH?6-$ vmd[RH?6-$ ulcZQH?6,# ulcZQH?6,# ulcZQH?6,# tkbYPG>5,# tkbYPG>5,# tkbYPG>5,# vqmrds[tRtHu?v6w-x$yz{ }~utlucuZvQwHw?x6y,z#z{| }txkxbyYyPzGz>{5{,|#|}} ~s|j|a|X}O}F}=}4~+~"~~ sjaXOF=4+" ri`WNF=4+" ri`WNF=4+" qh_VNE<3*! qh_VNE<3*! pg^VMD;3*! pg^VMD;3*! of^ULC;2)  of^ULC;2)  of^ULC;2)  of^ULC;2)  ne]TKC:1)  vpwqwrxsxtyuyvtzve{wV{xG|y8|z)}{}| ~twuxuxvywywzxzty{ez{Vz|G{|8|}(|}}~ ~s~t~u~u~v~wxsxdyUzFz7{(|} ~qrsttuvrwdxUyFz7{({| ~pqrstuvrvcwTxEy6z({| ~opqrstuqvbwTxEy6z'{| ~nopqrstqubvSwDx6y'z{ ~mnopqrtqubvSwDx6y'z{ ~lmnoqrsptauSvDx5y'z{ ~klmopq~rosauRvDw5x&y{ }jkmnop~rosatRuDw5x&yz }ijlmnp}qor`tRuCv5x&yz }ijlmnp}qor`tRuCv5x&yz }hiklno}por`sRtCv5w&yz }hiklno}pnr`sQtCv4w&yz }ghjkmn}pnq`sQtCu4w&xz }{p{q|r|s|t|u}}vn}v`}wQ~xC~y4~z&~{| ~zvzw{w{x{x|y||yn|z_}{Q}{B}|4~|%~}~} x}x}y}y~z~z~|{~m{~_|~P|B}3}%~~ wxxyyz{zm{^{P|A|3}%}~ vwwxxyzylz^{O{A|3|$}} tuuvwwzxky]zOzA{2|$|} sttuvwzwkx]yOzAz2{$|} ~rsttuvywkx]xNy@z2{$|| ~qrsttuxvjw\xNy@z2z#{| ~pqrstuxvjv\wNx@y2z#{| ~pqrstuxvjv[wMx?y1z#{| ~opqrstxujv[wMx?y1z#{| ~nopqrswtiu[vMw?x1y#z| ~nopqrswtiu[vMw?x1y#z| ~nopqrswtiu[vMw?x1y#z| ~mnopqrvthuZvLw>x1y#z{ ~pqrstuwviv[wMx?y1z#{| ~vwwxxyvyhzZ{L{>|1|#}} ~}~}~}~~~~~v~h~Z~L>0" |||}}}u}g~Y~K~>~0" {{||||t}g}Y}K~=~/~"~ zz{{{|t|f|X}J}=}/~!~ yyzz{{s{e|X|J}<}/}!~~ xxyyzzr{e{W|J|<}.}!}~ wxxyyzrze{W{J|<|.}!}~ vwwxxyrydzW{I{;|.| }~ vwwxxyrydzW{I{;|.| }~ uvvwxxqydyVzI{;{.| }~tuuvwwqxdyVzIz;{.| |}tuuvw~wpxcyVzHz;{-| |}tuuvw~wpxcyVzHz;{-| |}stuuv~wpwcxVyHz;z-{ |}pqrst~upvcvVwHx;y-z {|~vwwxx}ypybzU{H{:|-|}}|||}}|}o}b~T~G~:~,|naTG9,{naSF9,{naSF9,zm`SF9+~~~~~zl_RE8+}}}~~z~l~_~R~E8+|||}}y}l}_~R~E~8~+{{|||x|k}^}Q}D~7~*~~{{|||x|k}^}Q}D~7~*~~zz{{{x|k|^|Q}D}7}*~~zz{{{w|j|^|Q}D}7}*~~yyzz{w{j{^|Q|D}7}*}~~yyzz{w{j{^|Q|D}7}*}~~opqrswtju^vQwDx7y*z{|~uvvwxwxjy]yPzC{6{*|}}{{|||v|i}\}P}C~6~)~~ui\OB6)uh[NB5(uh[NB5(tg[NA5(sgZMA4(sgZMA4(rfYM@4'rfYM@4'~reYL@3'~reYL@3'}qeXL?3'}qeXL?3'}qeXL?3'opqr}sqteuXvLw?x3y'z{|~uvvw}xpxdyXyKz?{3{&|}~{{||||p|c}W}K}>~2~&~~|pcWK>2&{ocVJ>2%znbVJ=1%zmaUI=1% ymaUI<0$ ymaUI<0$ xl`TH<0$ xl`TH<0$ wk_SG<0$ wk_SG<0$ wk_SG<0$ wk_SG<0$ vk_SG;/# opqrwskt_uSvGw<x0y$z{ |~uvvwvxkx_ySyGz;{/{#|} ~zz{{v{j|^|R|F};}/}#~~ ui]RF:.# th]QE:." th]QE:." sh\PE9-" ~sg[PD9-! ~sg[PD9-! }rf[OD8-! }rf[OD8-! }qfZOC8,! }qfZOC8,! |peYNC7,  |peYNC7,  |peYNC7,  opq}rqsftZuOvCw8x,y!z{ }tuu|vpwewYxNyCz7z,{ || ~yyz{zp{d{Y{M|B|7}+} }~ ~~~z~o~cXMB6+  yncWLA6* xmbWL@5* xmbWL@5* xlaVK@5* xlaVK@5* wlaVJ?4) wlaVJ?4) vk`UJ?4) vk`UJ?4) vk`UJ?4) uj_TI>3( uj_TI>3( opqvrks`tUuJv?w4x)yz{ }tuuuvjw_wTxIy>z3z({|| ~yyztzi{^{T{I|>|3}(}}~ }}~}s~i~^~S~H~=~2' ~si^SH=2' }sh]RG=2' }rg\RG<1' }rg\RG<1' |qf\QF<1& |qf\QF<1& {pf[PF;0& {pf[PF;0& zoeZPE;0% zoeZPE;0% zoeZPE;0% zoeZPE;0% no{ppqfr[sPtFu;v0w&xy{ }stzuouevZwPwEx;y0z%z{| ~xxyynydzYzO{D{:|/|%}}~ ||x|n}c}Y}N}D~9~/~%~ xncYND9/% wmbXNC9.$vlbWMC8.$vlbWMC8.$ukaWLB8.#ukaWLB8.#uj`VLA7-#uj`VLA7-#~tj_UKA7-"~tj_UKA7-"~tj_UKA7-"~tj_UKA7-"noupjq`rVsLtAu7v-w#xy{}s~ttuju_vUwKwAx7y-z"z{|~w~xtxjy_yUzKzA{7{-|"|}~|}|s|i}_}T}J}@~6~,~"~|rh^TJ@6,"{qg]SI?5+!{qg]SI?5+!zpf\RH>5+!zpf\RH>5+!yoe\RH>4*  yoe\RH>4*  xne[QG=3*  xne[QG=3*  xne[QG=3*  wmdZPF=3) wmdZPF=3) nyoopeq\rRsHt>u4v*w xy {}rysotet\uRvHw>x4x*y z{ |~wxxnxey[yQzGz={3{*| |} ~{w{m|d|Z|P|F}=}3})~~~ vmcYPF<2) ulbXOE;2( ulbXOE;2( ~tkaXND;1( ~tkaXND;1( }sj`WMD:1' }sj`WMD:1' |si`VMC:0' |si`VMC:0' |si`VMC:0' |si`VMC:0' {rh_ULC90& ~ntokpaqXrNsDt;u1v(wxy {}}rssjt`tWuMvDw:x1x'yz{ }~|vswiw`xVxMyCy:z0{'{|| ~|zszi{`{V{M|C|:|0}'}}~ {~r~h~_~U~LC90& zqg^UKB9/& zqg^UKB9/& ypf]TKA8/% ypf]TKA8/% xof\SJA7.% xof\SJA7.% wne[RI@7.$ wne[RI@7.$ wne[RI@7.$ vmd[RH?6-$ vmd[RH?6-$ znqogp^qUrKsBt9u/v&wxy |~yrpsft]tTuKvAw8x/x%yz{ }~xvowfw\xSxJyAy7z.{%{|| ~wznze{[{R{I|@|7|.}$}}~ v}m}d}[~R~H~?~6~-~$ vmd[RH?6-$ ulcZQH?6,# ulcZQH?6,# tkbYPG>5,# tkbYPG>5,# sjaXOF=4+" sjaXOF=4+" ri`WNF=4+" ri`WNF=4+" ri`WNF=4+" ri`WNF=4+" vmmndo[pRqHr?t6u-v$wxy {~uqlrcsZtQtHu?v6w,x#yz{ }~tukvbvYwPxGx>y5y,z#{{| ~tykybzYzP{G{>{5|,|#}}~ s}j}a}X~O~F~=~4~+~" ri`WNF=4+" ri`WNF=4+" qh_VNE<3*! pg^VMD;3*! pg^VMD;3*! pg^VMD;3*! of^ULC;2)  of^ULC;2)  of^ULC;2)  ne]TKC:1)  ne]TKC:1)  pmgn^oVpMqDr;t3u*v!wxy |~pqgr^sVtMtDu;v3w*x!yz{ }~oufv^vUwLxCx;y2y)z {{| ~nxex]yTyKzCz:{1{)| |}} ~m|d|\|S}K}B}9}1~(~ ~~ md\SKB91(  lc[RJA90( kcZRIA80' kcZRIA80' jbYQH@7/'jbYQH@7/'jbYQH@7/'iaXPG?7.&iaXPG?7.&iaXPG?7.&iaXPG?7.&sltmtnuovqwrwspxtayuSzvD{w5{y'|z}{ ~}qsrtsututvuw~vwowxaxyRyzDzz5z{&{||} ~~pzqzr{s{t{u|}v|ov|`w}Rx}Cy}5z~&{~| ~nopqrs}tnu`vQwCx4y&z{ ~mnopqr|tnu_vQwBx4y%z{ ~klmopq|rms_uPvBw3x%z{ ~jkmnop{rms^tPuAw3x%yz }ijlmnpzqlr^tOuAv3x$yz }hiklnozpkr]sOtAv2w$yz }ghjkmnzpkq]sOtAu2w$xz }fhiklmyokp]rNs@u2v$xz }eghjkmynkp]qNs@u2v$xy }eghjkmxnjp\qNs@u2v#xy }dfgijlxnjo\qNr@t2v#wy }dfgijlxnjo\qNr@t2v#wy }cefhjkxmjo[pMr?t1u#wy }xlxmynyozqzrx{sj{t\|uN|v@}x2}y#~z~{ }wsxtxuyuyvzwxzwj{x[{yM|z?|z1}{#}|~} ~uyvyvzwzx{x{wy{iy|[z|M{}?{}1|}#}~}~ tuuvwwvxhyZzLz>{1|#|} rsttuvvwhxZxLy>z0{"|} ~qrsttuuvgwYxKy>z0z"{| ~pqrstutvgvYwKx=y/z"{| ~opqrsttugvYwKx=y/z"{| ~nopqrsttfuXvJw=x/y!z| ~mnopqrsteuXvJw<x/y!z| ~l}ICC_PROFILEmnoqrssetXuJv<x/y!z{ ~klmopqrresWuJv<w.x!y{ ~jkmnoprresWtJu<w.x!y{ ~jkmnoprresWtJu<w.x!y{ ~ijlmnprqdrWtIu;v.x y{ ~ijlmnprqdrWtIu;v.x y{ ~~l~m~n~o~qrrsetWuJv<w.y!z{ }|r|s|t}t}u}vr}wd~xW~xI~y;~z.{ || ~{y{y|z|z|{|{q}{d}|V}|I~};~}.~} ~~~yyzz{~{p{c|V|H};}-} ~~xxyyz}zp{b{U|H|:}-}}~wxxyy|zozb{T{G|:|,}}~uvvwx|xnyayTzG{9{,|}~tuuvw{wnxaySzFz9{,||}stuuv{wnwaxSyFz9z,{|}rsttuzvmw`xSxFy9z+{|}rsttuzvmw`xSxFy9z+{|}qrsttzulv_wRxEy8z+z{}~pqrstzulv_vRwEx8y+z{}~pqrstyulv_vRwEx8y+z{}~opqrsytlu_vRwEx8y+z{|~opqrsytlu_vRwEx8y+z{|~lmnoqzrls_tRuEv8w+yz{~rsttuyvlw_xRxEy8z+{|}~xxyyzxzk{^{Q|D|7}*}~~~~~~~wj^QD7*}}}~~w~j~]~P~C6*|||}}v}i}\~P~C~6~){{|||u|i}\}O}B~6~)~~zz{{{u|h|[|N}B}5}(~~yyzz{u{h{[|N|B}5}(}~xxyyztzg{[{N|A|5}(}~~wxxyytzgz[{N{A|5|(}}~wxxyyszgzZ{M{A|4|(}}~vwwxxsygyZzM{A{4|(|}~vwwxxryfyYzM{@{4|'|}~uvvwxrxfyYyMz@{4{'|}~uvvwxrxfyYyMz@{4{'|}~lmnoqsrgsZtMuAv4w(yz{~rstturvfwYxMx@y4z'{|}xxyy~zrze{Y{L|@|3}'}~~}}}~}~q~e~X~L~?3'}pdXK?3&|pcWK>2&{ocVJ>2%znbVJ=1%znbVJ=1%~~~~z~maUI=1% }}}~z~m~a~U~I~=1% |||}y}m}a}U~I~<~0~$~ |||}y}m}a}U~I~<~0~$~ {{||y|m|a}U}I}<~0~$~~ {{||x|l|`}T}H}<~0~$~~ zz{{x{l|`|T|H}<}0}$~~ lmnoyqmrasUtIu<v0x$yz |~qrstxtlu`vTwHx<y0z$z{ }wxxywykz_zS{G{<|0|$}} ~|||}v}k}_}S~G~;~/~# vj^RF;/# ui]RF:.# ui]RF:.# th]QE:." sh\PE9-" sh\PE9-" ~sg[PD9-! ~sg[PD9-! }rf[OD8-! }rf[OD8-! }rf[OD8-! }qfZOC8,! lmn~osqgr[sPtDu9v-w!yz |~qrs}trtfu[vOwDx8y-z!z{ }vww}xqxfyZyOzC{8{,|!|} ~{{|||p|e|Y}N}C}7~,~ ~~ {pdYMB7+  zocXMB6+  yncWLA6* yncWLA6* xmbWL@5* xmbWL@5* xlaVK@5* xlaVK@5* wlaVJ?4) wlaVJ?4) wlaVJ?4) vk`UJ?4) klmxolpaqVrKs@u5v*wxz |~qrswtltauVvJw?x4y)z{{ }vwwvxkx`yUyJz?{4{)||} ~{{|u|j|_|T}I}>}3~(~~~ ti^TI>3( ~si^SH=2' ~si^SH=2' }sh]RG=2' }rg\RG<1' }rg\RG<1' |qf\QF<1& |qf\QF<1& |qf\QF<1& {pf[PF;0& {pf[PF;0& {pf[PF;0& kl|mqofp\qQrFs<u1v&wxz |~pq{rpsft[uPvFv;w0x&yz{ }uvzvowexZxPyEy;z0{%{|} ~zzz{o{e{Z|P|E|;}0}%}~~ ~~y~n~d~YOD:/% xncYND9/% wmbXNC9.$wmbXNC9.$vlbWMC8.$ukaWLB8.#ukaWLB8.#ukaWLB8.#uj`VLA7-#uj`VLA7-#uj`VLA7-#~tj_UKA7-"klumkoapWqLrBs8u.v#wxz}~pqurjs`tVuLvAv7w-x#yz{~t~utujv_wUwKxAy7z-z"{|}~y~ytzjz_{U{K{A|7|-}"}}~}}}s}i~_~T~J~@~6~,"|rh^TJ@6,"{qg]SI?5+!{qg]SI?5+!zpf\RH>5+!zpf\RH>5+!yoe\RH>4*  yoe\RH>4*  xne[QG=3*  xne[QG=3*  xne[QG=3*  wmdZPF=3) kzlpmfo\pRqHr>s5u+v!wxz}oypoqer\sRtHu>v4w*x yz {~txunuev[wQwGx=y3z*z {| }~xwxmydyZzPzF{={3|)|}} ~|v|m|c}Y}P}F}<~2~)~~ vmcYPF<2) ulbXOE;2( ~tkaXND;1( ~tkaXND;1( }sj`WMD:1' }sj`WMD:1' |si`VMC:0' |si`VMC:0' |si`VMC:0' {rh_ULC90& {rh_ULC90& ~ktlkmaoXpNqDr;s1u(vwx z}}ospjq`rWsMtDu:v1w'xyz |~|sstiu`uVvMwCw:x0y'zz{ }~{wrxhx_yUyLzCz9{0{&||} ~{{r{h|_|U|L|C}9}0}&~~~ zqg^UKB9/& ypf]TKA8/% ypf]TKA8/% xof\SJA7.% wne[RI@7.$ wne[RI@7.$ wne[RI@7.$ vmd[RH?6-$ vmd[RH?6-$ vmd[RH?6-$ ulcZQH?6,# yjpkfm]nToKpAr8s/t%uwx z}xoopfq\rSsJtAu7v.w%xyz |~wsnteu[uRvIw@w7x.y$zz{ }~vwmxdx[yRyHz?z6{-{$||} ~u{l{c|Z|Q|H|?}6},}#~~~ u~l~c~Z~Q~H?6,# tkbYPG>5,# sjaXOF=4+" sjaXOF=4+" ri`WNF=4+" ri`WNF=4+" qh_VNE<3*! qh_VNE<3*! qh_VNE<3*! qh_VNE<3*! pg^VMD;3*! ujlkcmZnQoHp?r6s,t#uwx {}tnkobpYqPrGs>t5u,v#wxz |~srjsatXtOuFv=w4x+x"yz{ }~rviw`wWxNxFy=y4z+{"{|} ~qzhz_{V{N{E|<|3|*}!}}~ p}g}^}V~M~D~;~3~*~! pg^VMD;3*! of^ULC;2)  ne]TKC:1)  ne]TKC:1)  ne]TKC:1)  md\SKB91(  md\SKB91(  lc[RJA90( lc[RJA90( lc[RJA90( qjhk_mVnNoEp<r3s*t!uwx {}pngo^pVqMrDs;t3u*v!wxz |~orfs^tUtLuCv;w2x)x yz{ }~nvew]wTxKxCy:y1z){ {|} ~mydy\zSzK{B{9{1|(| }}~ m}d}\}S~K~B~9~1~(~  lc[RJA90( kcZRIA80' kcZRIA80' jbYQH@7/'jbYQH@7/'jbYQH@7/'iaXPG?7.&iaXPG?7.&iaXPG?7.&h`WOG>6.% kjckZmRnIoAp8r0s'tuwx {}kmcnZoRpIqAr8t0u'vwxy |~jqbrYsQtHt@u7v/w'xyz{}~iuavXvPwGx?x7y.y&z{{}~hx`xWyOyGz>z6{.{%||} ~g|_|V|N}F}>}5}-~%~~~ g_VNF>5-% f^VME=5-$ e]UMD<4,$ e]UMD<4,$ e]UMD<4,$ d\TLD<3+# d\TLD<3+# c[SKC;3+# c[SKC;3+# c[SKC;3+# qhrisktltnuozvplwr^xsOytAzv3{w${y|z ~}ooppqqrrssttzuukvv]wwOxxAyy2zz${{|| ~~mvnwowpxqxryytykuz]v{Nw{@x|2y|$z}{} ~k}l}m}o~p~q~xr~js~\u~Nv@w2x#y{ ~jkmnopxrjs[tMu?w1x#y{ ~hiklnowpir[sMt?v1w#yz }ghjkmnvphqZsLt>u1w#xz }eghjkmvnhpZqLs>u0v"xz }dfgijlungoYqKr>t0v"wy }cefhjkumgoYpKr>t0u"wy }bdegiktlgnYpKr=s/u"wy }acefhjtlgmYoKq=s/u"vy }acefhjtlfmXoJq=s/u!vy }`bdfgitkfmXoJq=r/t!vy }_acegitjflXnJp=r/t!vy }_acegisjelXnJp<r/t!vy }vhwiwkxlxnyotypgzrY{sK{t=|v/|w"}y~z }toupuqvrwswtsxueyvXywJzx<{y/|z!|{}| ~rvswtwtxuxvyrwyexzWx{Jy{<z|.{|!|}}} q|r|s|t}t}u}rv}dw~Wx~Iy~;z~.z {} ~opqrstqudvVwIx;y.z {|~nopqr~sptcuVvHw;x-y z|~lmnoq~rpsctVuHv;w-y z{~klmop}qprbsUuHv:w-xy{~jkmno|porbsTtGu:w,xy{~ijlmn|pnqarTtGu9v,xy{~hikln|onparTsGt9v,wy{~ghjkm{nnpaqSrFt9u,wx{~fhikl{mnoapSrFs9u,vxz~fhikl{mnoapSrFs9u,vxz~eghjkzmmn`pSqFs9u+vxz}eghjkzmmn`pSqFs9u+vxz}{i{j|l|m|n{|pn}qa}rS}tF~u9~v,~xyz}yoypzqzr{sz{tm{u`|vS|wF}x9}y+}z~{~|~xuxvyvywzxzzxl{y_{yR|zE|{8}{+}|}}~}v{w{w|x|x|yy|ly}_z}R{}E{~8|~+|~}~~tuuvwxwkx^yQzDz7{*||}sttuvwwjw^xQyDz7{*{|}rsttuwvjw]xPxCy6z*{|}qrsttwujv]wPxCy6z*{{}opqrsvtiu\vPwCx6y)z{}~nopqrusit\uOvBw6x)yz|~nopqrusit\uOvBw6x)yz|~mnopqurht[uNvBw5x(yz|~lmnoqurhs[tNuBv5x(yz|~lmnoqurhs[tNuBv5x(yz|~klmoptqgr[sNuAv5w(xz|~jkmnotpgr[sNtAu5w(xy|~ijlmnuphq[rNtBu5v(xyz}~o~p~q~r~sttgu[vNwAx5y(z{|~}u}v}v~w~xs~xg~yZ~yM~zA{4{(|}~{z{z|{|{|{r||f}|Y}|M}}@~}4~}'~~~~zz{{~{r|e|Y|L}@}3}'~~yyzz}{q{e{X|L|?}3}'}~wxxy}ypzdzX{K{?|3|&}}~vwwx}xpydyXzK{?{3|&|}~uvvw|xpxcyWyKz>{2{&|}~tuuv{wowcxVyJz>z2{%||~stuu{vowcxVxJy>z2z%{|~stuuzvnwbwVxJy=z1z%{|~rsttzunvbwVxJx=y1z%{|}qrstztnubvVwJx=y1z%{{}qrstztmuavUwIx=y1z%{{ }pqrsztmuavUvIw=x1y%z{ }hikl{noocpVrJs>t2v%wy{}nopqzrmsatUuIv=w1x%yz |~tuuvywmwaxUyIz<z0{$|| ~zz{{x{l|`|T|H}<}0}$~~ wk_SG<0$ ~~~~w~k_SG<0$ }}}~v~k~_~S~G~;/# |||}v}j}^}R~F~;~/~# {{||u|i|]}R}F}:~.~#~~ zz{{u{i|]|R|F}:}.}#~~ yyzzt{h{]{Q|E|:}.}"~~ xxyytzhz]{Q{E|:|.}"}~ xxyyszhz\{P{E|9|-}"}} wxxysyhz\zP{E{9|-|"}} ~wxxysyhz\zP{E{9|-|"}} ~vww~xsxgy[yPzD{9{-|!|} ~hikltnho]pQrEs:t.v"wy {~nopqsrhs\tPuEv9w-x"yz |~stu~usvgw[wPxDy9z-z!{| }yyz}zr{f{[{O|D|8}-}!}~ ~~~}~q~fZOC8,! |peYNC7,  {pdYMB7+  {pdYMB7+  zocXMB6+  zocXMB6+  yncWLA6* ~~~y~n~cWLA6* }}}x~m~b~W~L~@~5* }}}x~m~b~W~L~@~5* |||x}m}b}W}L~@~5~*~ |||x}l}a}V}K~@~5~*~ hikylnncoWpLrAs6t*vwy {~nopxqmrbsWtLu@v5w*xyz }~stuxulvawVwKx@y5z*z{| ~xxywylzazV{J{?|4|)}}~ }}}v~k~`~U~J~?~4) uj_TI>3( ti^TI>3( ti^}ICC_PROFILETI>3( ~si^SH=2' ~si^SH=2' }sh]RG=2' }sh]RG=2' }rg\RG<1' }rg\RG<1' }rg\RG<1' |qf\QF<1& hi}kslhn]oRpGr=s2t'vwy |~mn}orpgq\rRtGu<v1w'xyz }~rs|tqtfu\vQwFx<x1y&z{| ~wx{xpyfy[zPzF{;{0|&|}} ||z|o}e}Z}P}E~;~0~%~ zoeZPE;0% yndYOD:/% xncYND9/% wmbXNC9.$wmbXNC9.$vlbWMC8.$vlbWMC8.$vlbWMC8.$ukaWLB8.#ukaWLB8.#ukaWLB8.#hiwkmlbnXoNpCr9s.t$vwy|~mnvolpbqWrMtCu8v.w$xyz}rsutktauWvLwBx8x.y#z{|~vwuwjx`xVyLyAz7{-{#||}{~{t|j|_|U|K}A}7}-~"~~}si_TJ@6,"}si_TJ@6,"|rh^TJ@6,"{qg]SI?5+!{qg]SI?5+!zpf\RH>5+!zpf\RH>5+!yoe\RH>4*  yoe\RH>4*  yoe\RH>4*  xne[QG=3*  h{iqkgl]nSoIp?r5s+t!vwy|~lzmpnfo\qRrHs>t5u+v!xyz}qyroset\tRuHv>w4x*y z{ |~uxvnvew[xQxGy=y3z*{ {| }~zwzm{d{Z{P|F|=|3})}}~ ~v~m~c~Y~PF<2) vmcYPF<2) ulbXOE;2( ~tkaXND;1( ~tkaXND;1( }sj`WMD:1' }sj`WMD:1' }sj`WMD:1' |si`VMC:0' |si`VMC:0' |si`VMC:0' huilkblXnOoEp;r2s(tvw y|~~ltmknaoXqNrDs;t1u(vwy {}}psqjr`sWtMuDv:v1w'xyz |~|usviv`wVxMxCy:y0z'{{| }{yryhz_zU{L{C{9|0|&}}} ~z}q}g}^~U~K~B~9~/~& ypf]TKA8/% ypf]TKA8/% xof\SJA7.% xof\SJA7.% wne[RI@7.$ wne[RI@7.$ vmd[RH?6-$ vmd[RH?6-$ vmd[RH?6-$ ulcZQH?6,# ygphfj]kTmKnAp8q/s%tuw y|~xlomfn\oSqJrAs7t.u%vxy {}wpnqer[sRtIu@v7v.w$xyz |~vtmudu[vRwHw?x6y-z$z{| }uxlxcyZyQzHz?{6{,|#|}} ~t|k|b|Y}P}G}>}5~,~#~~ tkbYPG>5,# sjaXOF=4+" ri`WNF=4+" ri`WNF=4+" qh_VNE<3*! qh_VNE<3*! qh_VNE<3*! pg^VMD;3*! pg^VMD;3*! pg^VMD;3*! tgkhbjYkPmGn>p5q,s#tuw z}~skjlamXoOpFq=r4s+u"vwx {}roip`qWrNsFt=u4v+w"xyz |~qsht_uVuNvEw<x3x*y!zz{ }pwgx^xVyMyDz;z3{*{!||} ~o{f{^|U|L|C|;}2})} ~~~ o~f~^~U~L~C;2)  ne]TKC:1)  md\SKB91(  md\SKB91(  lc[RJA90( lc[RJA90( lc[RJA90( kcZRIA80' kcZRIA80' kcZRIA80' pggh^jVkMmDn;p3q*s!tuw z}okfl^mUoLpCq;r2s)u vwy {}noep]qTrKsCt:u1v)w xyz |~msdt\uSuKvBw9x1x(y zz| }lvcw[wRxJxAy9y0z({{|} ~kzczZ{R{I{A|8|0|'}}}~ j}b}Y}Q~H~@~7~/~'~jbYQH@7/'iaXPG?7.&iaXPG?7.&h`WOG>6.% h`WOG>6.% g_VNF>5-% g_VNF>5-% g_VNF>5-% f^VME=5-$ lgch[jRkJmAn9p0q(stuw z}kkclZmRoIpAq8r0s'uvwy {~jnboYpQqHr@s7t/u'vwxz|~irasXtPtGu?v7w.x&xyz{}~hv`wWwOxGx>y6y.z%{{| }~hy`yWzOzG{>{6{.|%|}} ~g}_}V}N~F~>~5~-~%~ f^VME=5-$ f^VME=5-$ e]UMD<4,$ e]UMD<4,$ d\TLD<3+# d\TLD<3+# c[SKC;3+# c[SKC;3+# c[SKC;3+# gg_hVjNkFm>n5p-q%stu x{}fj^kVmMnEo=p5r-s$tuw y|~en]oUpMqDr<s4t,u$vwx z}~dq\rTsLtDt<u3v+w#xyz {}~cu[vSvKwCx;x3y+y#z{{ }~bxZxRyJyBz:z2{*{"||} ~b{Z{R|J|B|:|2}*}"}~~ a~Y~Q~I~A~91*" `XPHA91)! `XPHA91)! _WOH@80(! _WOH@80(! ^VOG?70(  ^VOG?70(  ^VOG?70(  ^VOG?70(  neogphqjrksmvtnhupZvqLws>xu0yv"zx|y ~|llmmnnooqqrrussgttYuuKvv>wx0yy"zz{{ ~}jsktmunuovpwtrwgsxYtyKuz=wz/x{"y|{} ~~hyiykzlzn{o{tp{fr|Xs|Jt}=v}/w}!y~z~ ~ghjkmnspeqXrJt<u/w!xz }eghjkmrnepWqJs<u.v!xz }cefhjkrmdoWpIr;t.u wz }bdegikqldnVpIr;s.u wy}acefhjqldmVoIq;s.u vy}_aceg~hpjclVnHp;r-t vy}^`bdf}hpjblUnHp:r-suy}]_ace}gpibkUmHo:q-suy}]_ace|goibkTmGo:q,suy}\^`bd|fohbkTmGo:q,sux}[]_ad|fohbjTlGn:p,rtx|[]_ad|fnhajTlGn9p,rtx|setgthujvk}wmpxnbxpUyqHzs:zu-{v|x}y}qlrmsntotq|urovsbwtTxuGyv:zx,zy{z}{~orpsqtrtsu|tvnuwavxTwxGxy9yz,z{{||}~~nxoxpyqyrz{sznt{au{Sv|Fw|9x},y}{~|~~lmnoqzrms`tSuFv9w+yz|~jkmnozplr_sRtEu8w+xy{~ijlmnyplq_rRtEu8v+xy{~ghjkmxnkp^qQsDt7u*wx{~fhiklwmjo^pQrDs7u*vx{~eghjkwmjn^pQqDs7u*vxz~dfgijwljn]oPqCr6t*vwz}cefhjwkjm]oPpCr6t*uwz}bdegivkil\nPpCr6s)uwz}bdegivkil\nPpCr6s)uwz}acefhvjil\mPoCq6s)uvz}`bdfguiik\mOoBq6r)tvz}xexgyhyjzkwzmj{n]{pP|qC|s6}u*}v~x~y}vlwmwnxoxqvyriys\ztP{uC{v6|w)|y}z~{~urvsvtwtxuuxviyw\yxOzxB{y6{z)|{}|~}sxtxtyuyvzuwzhw{[x{Ny|Bz|5{}({}|~}~q~r~s~t~t~tugv[wNxAy5z(z{}pqrstsugvZvMwAx4y(z{}nopqrrsftYuMv@w4x'yz|~mnop~qrretYuLv@w3x'yz|~lmno~qrresYtLu@v3w'yz|~klmo}pqqerXsLu?v3w'xy|~jkmn}oppdrXsKt?u3w&xy|~ijlm}nppdqXrKt?u3v&wy|~hikl|npocpWrKs>t2v&wy|~ghjk|mpncpWqKs>t2u&wx{~ghjk|mpncpWqKs>t2u&wx{~fhik{lomcoVpJr>s2u%vx{~}e}g}h~j}~kp~md~nX~pK~q?s3u&vxz}{k{l|m|o||pp|qc}rW}sK}u>~v2~w&~x~y{~zqzr{s{t{{to|uc|vV|wJ}x>}y2}z%~z~{}xwxxyxyyzzynzzb{zV{{J|{=||1}|%}}}}~~w}x}x}y~zy~mz~az~U{~I{~=|1|%}} ~uvvwyxmxayUyIz<{0{$|} ~tuuvxwlw`xTyHz<z0{$|| ~rsttxulv`wTxHx<y0z${| ~qrstwtku_vSwGx<y0z${{ }pqrsvtku_vSvGw;x/y#z{ }opqrvskt_uSvGw;x/y#z{ }nopqvrjs^tRuFv;w/x#yz }~nopqvrjs^tRuFv;w/x#yz }~mnopuqir]tRuFv:w.x#yz }mnopuqir]tRuFv:w.x#yz }lmnouqir]sRtFu:v.w#yz }~eghjvkkm_nSpGq;s/u#vx z}klmovpjq^rRsFu;v/w#xy |~qrstutiu]vRwFx:y.z#z{ }}v}w}w~xt~xh~y]~yQ~zE~{:{.|"|} ~||||||}}s}}h}}\}}P~~E~~9~~-~~"~ zz{~{s{g|[|P|D}9}-}!~~ yyz}zr{f{[{O|D|8}-}!}~ xxy}yqzfzZ{O{C|8|,}!}~ wxx|ypyezYzN{C{7|,| }} ~vww|xpxeyYyNzC{7{,| |} ~uvv{wpxdxYyMyBz7{+{ |} ~tuu{vpwdwYxMyBz7z+{ || ~stuzuovcwXwMxBy6z+{ {| ~stuzuovcwXwMxBy6z+{ {| ~rstztoucvXwMxBx6y+z {| ~rstytnucvWwLxAx6y*z{| ~egh{jpkdmYnMpBq7s+u vx z}klmzoopcqXrMsBu6v+w xy |~pqrysntcuWvLvAw6x*yz{ }uvvxwmxbxWyLy@z5{*{|} ~{{|x|l|a|V}K}@}5~*~~~ wlaVJ?4) ~~~w~l~aVJ?4) }}}v~k~`~U~J~?~4) |||u}j}_}T}I~>~3~(~ {{|u|j|_|T}I}>}3~(~~ zz{t{i{^|T|I|>}3}(}~~ zz{t{i{^|T|I|>}3}(}~~ yy~zszi{^{S{H|=|2}'}}~ xx~ysyiz^zS{H{=|2|'}}~ xx~ysyiz^zS{H{=|2|'}}~ wx}xsyhy]zRzG{={2|'|}~ eghtjik^mTnIp>q3s(uvx {~jk~msnio^pSrHs=t2u'wxy |~pq}rssht]uRvGv=w2x'yz{ }uv}vrwgx\xRyGy<z1{'{|} ~zz|{q{f{\|Q|F|<}1}&}~~ ~~|~q~f~\QF<1& {pf[PF;0& zoeZPE;0% yndYOD:/% yndYOD:/% xncYND9/% xncYND9/% wmbXNC9.$~~w~m~b~XNC9.$~~w~m~b~XNC9.$}}v}l~b~W~M~C~8~.$egyhnjdkYmOnDp:q/s%uvx {~jkxmnncoYpNrDs9t/u%wxy |~opwqmrbsXtNuCv9w.x$yz{}tuvulvbwWwMxCy8z.z${|}~yyuzkza{W{L{B|8|.}#}}~}}u}j~`~V~L~A~7~-#~tj_UKA7-"}si_TJ@6,"}si_TJ@6,"|rh^TJ@6,"|rh^TJ@6,"{qg]SI?5+!{qg]SI?5+!zpf\RH>5+!zpf\RH>5+!zpf\RH>5+!e}gshij_kTmJn@p6q,s"uvx{~j|krmhn^oTpJr@s6t,u"wxz|~n{oqpgq]rSsIt?u5v+w!xy{}sztpufu\vRwHw>x5y+z!z{}~xyxoyey\zRzH{>{4|*| }} ~|x|n|e}[}Q}G}=~3~*~ ~ wmdZPF=3) vmcYPF<2) vmcYPF<2) ulbXOE;2( ulbXOE;2( ~tkaXND;1( ~tkaXND;1( }sj`WMD:1' }sj`WMD:1' }sj`WMD:1' evgmhcjYkPmFn<p2q)suv x|~iujllbmXnOpEq;r2t(uvx z}~~ntokpaqXrNsDt;u1v(wxy {}}rssjt`tWuMvDw:x1x'yz{ }~|wsxix`yVyMzCz:{0{'||} ~{{r{h|_|U|L|C}9}0}&~~~ zqg^UKB9/& zqg^UKB9/& ypf]TKA8/% xof\SJA7.% xof\SJA7.% wne[RI@7.$ wne[RI@7.$ wne[RI@7.$ vmd[RH?6-$ vmd[RH?6-$ zeqggh^jUkKmBn9p/q&suv y|~yipjfl]mTnKpAq8r/t%uvx z}xmonfo\pSqJrAt7u.v%wxy {}wrnset[tRuIv@w7x.x$yz{ }~vvmwdw[xRxHy?y6z-{${|| ~uzlzc{Z{Q{H|?|6|,}#}}~ t}k}b}Y~P~G~>~5~,~# tkbYPG>5,# sjaXOF=4+" ri`WNF=4+" ri`WNF=4+" qh_VNE<3*! qh_VNE<3*! qh_VNE<3*! pg^VMD;3*! pg^VMD;3*! tdkfbgYiPjGl>n5o,q#rtv y|~sijjalXmOnFp=q4r+t"uvx z}rmin`oWpNqFr=t4u+v"wxy |~qqhr_sVtNtEu<v3w*x!yz{ }~pugv^vVwMxDx;y3y*z!{{}ICC_PROFILE| ~oyfy^zUzL{C{;{2|)| }}~ o|f|^|U}L}C};}2~)~ ~~ ne]TKC:1)  md\SKB91(  md\SKB91(  lc[RJA90( lc[RJA90( kcZRIA80' kcZRIA80' kcZRIA80' jbYQH@7/'odff^gUiLjCl;n2o)q rtv y|~nhei]kTlKnCo:p1r)s tvx {}mldm\nSoKqBr9s1t(u vwy |~lpcq[rRsJtAu9v0v(wxy{ }~ktcuZuRvIwAw8x0y'zz{| ~jxbxYyQyHz@z7{/{'||}}j{b{Y|Q|H|@|7}/}'}~~~iaXPG?7.&h`WOG>6.% h`WOG>6.% g_VNF>5-% g_VNF>5-% f^VME=5-$ f^VME=5-$ f^VME=5-$ e]UMD<4,$ kdcfZgRiIjAl8n0o'qrtv z}~jhbiYkQlHn@o7p/r'stvx{}ilamXnPoGq?r7s.t&uvxy|~hp`qWrOsGt>u6v.v%wxy {}~gs_tVuNuFv>w5w-x%yzz |~fw^xVxMyEy=z5z-{${|| }~ez]zU{M{D{<|4|,|$}}} ~e}]}U}M~D~<~4~,~$~ d\TLD<3+# c[SKC;3+# c[SKC;3+# c[SKC;3+# bZRJB:2*" bZRJB:2*" bZRJB:2*" aYQIA91*" gd_fVgNiFj>l5n-o%qst vz}fh^iVkMlEn=o5p-r$stv x{}ek]lUmMoDp<q4r,s$uvw y|~do\pTqLrDs<t3u+v#wxy {}~ds\tTuLuDv<w3w+x#yzz |~cv[wSwKxCx;y3y+z#{{| }~byZyRzJzB{:{2{*|"|}} ~a}Y}Q}I~A~9~1~*~"~ aYQIA91*" `XPHA91)! _WOH@80(! _WOH@80(! _WOH@80(! ^VOG?70(  ^VOG?70(  ^VOG?70(  bdZfRgJiBj:l2n*o"qrt wz}agYhQjIkAm9n1p*q"rtu x{}`kXlPmHoAp9q1r)s!uvw y|~_nWoOpHq@r8s0t(u!vwx {}~^rVsOtGt?u7v0w(x xyz |~]uUvNvFw>x7x/y'yz{| }~]xUxNyFy>z7z/{'{||} ~\{T{M|E|=|6|.}'}}~~ [~S~L~D~=~5.& [SLD=5.& ZRKC<4-% ZRKC<4-% YRJC;4,% YRJC;4,% YRJC;4,% XQIB:3,$ lbmdneogqirkrsldtnWupIvr;ws.yu zw|x ~|jikjmlnmonppqrqdsrVttIuu;wv.xx yy{z~}hoipkqlrns~otppucrvVswHtx;vy-wz y{{|~~fvhwiwjxlx}mypoybpzUr{Hs{:u|-v|x}z}}d|f|g|i}j}|l}on}bo~Tq~Gs~:t~,vwz}bdegi|knlanTpGr9s,uwz}`bdfg{inkamSoFq9r,tvy}_acegzimj`lSnFp9r+tvy}]_acezgli_kRmEo8q+suy}\^`bdzflh_kRmEo8q+suy}[]_adyflh_jRlEn8p+ruy}Z\^acyelg_iRkEn8p+rtx}Y[]`bxdkf^iQkDm7o*rtx|XZ]_axdkf^hQjDm7o*qtx|WY\^`wcje^hQjDl7o*qsx|WY\^`wcje^hQjDl7o*qsx|qbrdsetgtiyuklvl_wnRxpEyr8zs+zu{w}y|oipjqlrmsnxtpkuq^vrQwtDxu7yv*zx{y|z~}monpoqprqswrtjtu^uvQvwDwx7xy*yzz{||~~kulvmvowpxwqxjry]syPuzCv{6w{*x|z}|}~i{j{l|m|n|vp|iq}\r}Pt}Cu~6v~)x~y~{~ghjkmunip\qOrBt6u)wx{~eghjkumhn[pNqBs5u(vx{~dfgijtlgn[oNqAr5t(vw{~cefhjskgmZoMpAr4t(uw{~acefhsjglZmMoAq4s(uvz}`bdfgrifkYmMo@q4r'tvz}_acegrifjYlMn@p4r'tvz}^`bd~frhejYlLn@p3r'tuz}^`bd~frhejYlLn@p3r'tuz}]_ac~ergeiYkLm@o3q'suy}\^`b}dqfehXjLm?o3q'suy}vbwdwexgxirykfylYznM{p@{r4|s'|u}w~y}thuiukvl~wnrwoexpYyrLzs@zt3{v'|w|y~z}rnsotptq}urqvsewtXxuLxv?yw3zx'{y|z}|~ptqurusv}twpuwdvxXvyKwz?xz3y{&z|{|}}nzozp{q{|r{ps|ct|Wu|Kv}>w}2x}&y~z~}~lmno{qorcsVtJu>v2w%yz|~klmozpnqbrVsJu=v1w%xy|~ijlmznmpaqUrIt=u1v%xy |~hiklznmoapUrIs=t1v%wy |~ghjkymmnapUqIr<t0u$wx |~fhikxllm`oTpHr<s0u$vx |~eghjxklm`nTpHq<s0t$vx {~dfgiwjkl_nSoGq<r0t$vw {~cefhwjkk_mSoGp<r0t$uw {~cefhwjkk_mSoGp<r0t$uw {~bdegvikk_lSnGp;r/s#uw {~{b{d|e|gy|im|ka}lU}nI}p<~r0~s$~u~w y}yhyizkzlx{nl{o`{pT|rH|s<}t0}v$}w~y {~wnxoxpyqvyrkzs_ztS{uG{v;|w/|x#}y}z ~|~utvuvuwvvxwjxw^yxRyyFzz;{z/{{#||}| ~~sytytzuzuv{iw{]w{Rx|Fy|:z}.z}#{}|~ ~rstttuhv]wQxEx:y.z"{| ~pqrstthu]vQvEw:x.y"z{ }opqrssht\uPvEw9x-y"z{ }nop~qsrgs[tPuDv9w-x!yz }lmn}orqfr[sOtDu8v-w!yz }~klm}orpfq[rOsDu8v-w!xz }~jkm}nqofpZrOsCt8u,w!xy |~jkm}nqofpZrOsCt8u,w!xy |~ijl}mqnfpZqOrCt8u,v!xy |~hik|lpneoYpNrCs7t,v wy |~hik|lpneoYpNrCs7t,v wy |~bde}grifk[lOnDp8r-s!uw z}~h~i~k}~lq~nfoZpOrCs8t,v!wy {~|n|o|p|}qp}re}sY}tN~uC~v7~w,~x yz |~zszt{u{{up{vd|wY|wM|xB}y7}z+}z ~{~| ~xxxxyyzyyozzczzX{{M{{B||6||+}} }}~~ w~x~x~yy~ny~czWzL{A{6|*|}} uvvxwmxbxWyLy@z5{*{|} ~tuuxvlwawVxKy@z5z*{|| ~stuxulvawVxKx@y5z*z{| ~rstwtluavVwJx?x4y)z{| ~qrswtltauVvJw?x4y)zz| ~pqrvskt`uUvJv?w4x)yz| ~opqvrks`tUuJv?w4x)yz{ }opqurjs_tTuIv>w3x(yz{ ~nopuqjr_sTtIu>v3w(xy{ }mnoupjq_rTtIu>v3w(xy{ }bdewgliakVlJn?p4r)suw z}hikvlkn`oUpJr?s4t)vwy {~mnoupjq_rTtIu>v3w(xyz }~rstttiu^vTwIx>x3y(z{| ~~w~x~~xs~yi~y^zSzH{={2|'|}} ||||}||s}}h}}]}}R}}G~~=~~2~~'~~ {{}|r|g|\|R}G}<}1~'~~ zz|{q{f{\|Q|F|<}1}&}~~ xx|yqyfz\zQ{F{<|1|&}}~ wx{xpyfy[zPzF{;{0|&|}~ vw{wpxfx[yPyFz;{0{&||} uvzvowexZxPyEy;z0{%{|} ~uvzvowexZxPyEy;z0{%{|} ~tuyunvdwYwOxDy:z/z%{|} ~tuyunvdwYwOxDy:z/z%{|} ~styunudvYwOwDx:y/z%z{} ~bd{epgfi[kPlFn;p0r&suw z}ghzjokemZnPpEq;s0t%uwx |~mnyonpdqYrOtDu:v/w%xyz }rsxtntcuYvNwDx9x/y%z{| ~vwwwmxbxXyNyCz9{.{$||}~{{v|l|b|W|M}C}8}.~$~~ukaWLB8.#ukaWLB8.#~~u~j~`~VLA7-#}~}t}j~_~U~K~A~7~-"|~|t|j}_}U}K}A~7~-~"~{}{s|i|_|T|J}@}6},~"~~z}zs{i{_{T|J|@|6},}"}~z}zs{i{_{T|J|@|6},}"}~y|yrzhz^{T{J{@|6|,}"}}~y|yrzhz^{T{J{@|6|,}"}}~bduejg`iVkLlAn7p-r#suw{~g~htjjk_mUnKpAq7s-t"uwy|~l}msnio_qTrJs@t6u,v"wyz}q|rrsht^tTuJv@w6x,y"zz|~u{vqvgw]xSxIy?y5z+{!{|}~zzzp{f{\{R|H|>|5}+}!}~~~y~o~e~\~RH>4*  xne[QG=3*  xne[QG=3*  wmdZPF=3) vmcYPF<2) vmcYPF<2) ulbXOE;2( ulbXOE;2( ulbXOE;2( ~~t~k~a~X~ND;1( bxdneeg[iQkGl=n3p*r su w{~gwhmjdkZmPnFp=q3r)tuw y|~kvlmmcoYpPqFr<s2u)vwx z}puqlrbsXtOuEv;v2w(xyz |~~ttukuavXwNwDx;y1z(z{| }~}ysyjz`zW{M{D{:|1|'}}} ~|}s}i}`~V~M~C~:~0~' {rh_ULC90& {rh_ULC90& zqg^UKB9/& ypf]TKA8/% ypf]TKA8/% xof\SJA7.% xof\SJA7.% xof\SJA7.% wne[RI@7.$ {brdhe_gUiLkCl9n0p&rsu x{~zfqhgi^jUlKmBo9p/r&suv y|~ykplfm]oTpKqAr8s/u%vwx {}xoopfq\rSsJtAu7v.w%xyz |~wtnueu[vRwIw@x7y.z$z{| }vxmxdy[yRzHz?{6{-|$|}} ~u|l|c|Z}Q}H}?}6~,~#~~ ulcZQH?6,# tkbYPG>5,# sjaXOF=4+" sjaXOF=4+" ri`WNF=4+" ri`WNF=4+" ri`WNF=4+" qh_VNE<3*! qh_VNE<3*! ubldceZgQiHk?l6n,p#rsu x|~tfkhbiYjPlGm>o5p,r#suw z}~sjjkamXnOoFp=r4s+t"uwx {}roip`qWrNsFt=u4v+w"xyz |~qsht_uVuNvEw<x3x*y!zz{ }pwgx^xVyMyDz;z3{*{!||} ~ozfz^{U{L{C|;|2|)} }}~ o~f~^~U~L~C;2)  ne]TKC:1)  md\SKB91(  md\SKB91(  lc[RJA90( lc[RJA90( kcZRIA80' kcZRIA80' kcZRIA80' pbgd^eVgMiDk;l3n*p!rsu y|~offh^iUjLlCm;o2p)r suw z}mjdk\mSnKoBp9r1s(t uwx {}lnco[pRqJrAs9t0u(vwxz |~lrcs[tRtJuAv9w0x(xyz{ }~kvcwZwRxIxAy8y0z'{{|} ~jybyYzQzH{@{7{/|'|}}~i}a}X}P~G~?~7~.~&~h`WOG>6.% h`WOG>6.% g_VNF>5-% g_VNF>5-% f^VME=5-$ f^VME=5-$ f^VME=5-$ e]UMD<4,$ kaccZeRfIhAj8l0m'oqsu y|~jebgYhQjHk@m7n/p'qsuwz}iiajXlPmGn?p7q.r&tuvx{}hm`nWoOpGq>r6t.u%vwx z|~gq_rVsNtFt>u5v-w%xyz {}~fu^vVvMwEx=x5y-y$z{{ }~ex]xUyMyDz<z4{,{$||} ~d{\{T|L|D|<|3}+}#}~~ c[SKC;3+# c[SKC;3+# bZRJB:2*" bZRJB:2*" aYQIA91*" aYQIA91*" aYQIA91*" `XPHA91)! ga_cVeNfFh>j5l-m%oqs uy|~ee]gUhMjDk<m4n,p$qsu wz}di\jTlLmDn<p3q+r#tuv x{~cm[nSoKpCq;r3t+u#vwx z|~bpZqRrJsBt:u2v*v"wxy {}~btZuRuJvBw:w2x*y"zz{ }~awYxQxIyAy9z1z*{"{|| ~~`zXzP{H{A{9|1|)|!}}~ ~_}W}O}H~@~8~0~(~!~ _WOH@80(! ^VOG?70(  ^VOG?70(  ]UNF>7/' ]UNF>7/' ]UNF>7/' \TME=6.' ca[cSeKfCh;j3l+m#oqs vy|~beZgRhJjBk:m2n*p"qsu w{}ahYiQkIlAn9o1p*r"stv x{}`lXmPnHoAq9r1s)t!uvx z|~_pWqOrHs@t8u0v(v!wxy {}~^sVtOuGu?v7w0w(x yz{ |~]vUwNwFx>x7y/y'z{{| }~]zUzN{F{>{7|/|'|}}~ ~\}T}M}E~=~6~.~'~~ [SLD=5.& [SLD=5.& ZRKC<4-% ZRKC<4-% YRJC;4,% YRJC;4,% YRJC;4,% ^aVcOeGf?h7j0l(m oqs vz}~]dUfNgFi>j7l/n'oqrt w{}\hTiMkEl=n6o.p'rstv y|~[kSlLmDo=p5q.r&suvw z|~ZoRpKqCr<s4t-u%vwxy {}~YrRsJtCt;u4v,w%xxyz |~XuQvIvBw:x3x,y$yz{| }~WxPxHyAy:z2z+{${||} ~W{P{H|A|:|2|+}$}}~~ V~O~G~@~9~2*# UNG?81*" UNG?81*" TMF>70)" TMF>70)" TMF>70)" SLE>7/(! j_kamcneog|phnrjaslTtnGup9wr,xtyv{x~|gfhhjikjmlznmmpo`qpSsrFts9uu+wvxx{z~}e}ICC_PROFILElgmhnjokqzmrlns_ptRquEsv8uw+vyxzz{}~csetfuhujvykwlmw_oxRpyErz8tz+u{w|z}}aycyezfzh{xj{kl{^m|Qo|Dq}7s}*u}v~z~}_acegwijj^lQnDp7r*tvy}]_acewgji]kPmCo6q*suy}[]_advfih\jPlCn6p)rty}Z\^acveig\iPkCn6p)rty}XZ]_audif\hOjBm6o)qtx}WY\^`uche[hNjBl5o(qsx|VX[]`ubhd[gNiBl5n(qsx|UWZ\_tagd[fNiAk5n(psx|TWY\^tagc[fNhAk5m(prx|TWY\^tagc[fNhAk5m(prx|SVX[]s`gcZeMhAj4m(orx|n_oapcqergushitj\ulOvnBwp6xr)ytzv|x~|lfmhniojqlurmhso[tpNurBvs5xu(yvzx|z~}jlkmmnnooqsprgrsZstMtuAuv4ww(xyyz|{~~hrisktltnurovfpwYrxMsx@ty4vz'w{y|{}~fxhxiyky~lzrmzeo{Yp{Lr|@s|3u}'v}x~{~~d~f~g~i~}j~qlenXoLq?r3t'vw{~bdeg}ipkdlXnKp?r3s&uw{~acef|hpjclWmKo>q2s&uvz~_ace|gphcjWlKn>p2r&tvz}^`bd{fohcjVlJn>p2r%tuz}]_aczengbiVkJm=o1q%suz}[]_azdnfbhVjJl=n1p%ruy}[]_azdmfahUjIl=n1p%ru z}Z\^azcmeagUiIk=n1p%rt y}Y[^`zbmdafUiIk=m1o%rt y}XZ]_yamdafUhIj<m0o$qt y}s_taucue{vgowhcxjVxlJyn>zp2zr%{t|v~x|qergshtjztknumbvnVwpJxq=ys1zu%{v{x}z}okplqmrozspmtqaurUvsIwu=xv1yw%zx{y }{~mqnrosptyqtmruatvUuwIvx<wy0xz$yzz{ }}~kwlxmxoyxpylqz`rzTs{Hu{<v|0w|$x}y} |~~i}j}l}m~wn~kp~_q~Sr~Gt~<u0v$xy |~ghjkvmkn_pSqGr;t/u#wx |~fhikvljm^oRpFr;s/u#vx |~eghjukim]nRpFq:s.u#vx {~cefhtjhk]mQoEp:r.t"uw {~bdegtihk]lQnEp:r.s"uw {~acefshhj\lPmEo9q-s"uw {~`bdfsghi\kPmEo9q-r"tv {~_acesghi\jPlEn9p-r"tv {~_ac~esggi[jPlDn9p-r!tv {~^`b~dsfgh[jPlDn9p-r!sv {~x_xaycyeuzgizh]{jR{lF|n:|p.}r#}t~v y}vewgwhxjsxkhym\ynPzpE{q9{s-|u"|v}x ~z}tkulum~voswpgwq[xrPysDzu9zv-{w!|x|y ~|~rqsrts}ttrutfvu[wvOxwDxx8yy-zz!{z|{ ~}pvqwrw}sxqtxfuyZvyOvzCw{8x{,y|!z|{} }~n|o|p||q}pr}es}Yt}Nu~Cv~7w~,x~ y{ }mno{ppqdrYtMuBv7w+x yz }klmzoopcqXrMsBu6v+w xz }jkmznoocpXrMsBt6u+w xz }~ijlymnncpWqLrAt6u*vxy |~hikxlmnboWpLr@s5t*vwy |~ghjxkmmbnWpLq@r5t*uwy |~fhixjmlbmWoLp@r5s*uvy |~eghxjlkamVnKp@q5s*uvy |~dfgxiljalVnKo@q5r*tvx |~dfgwiljalVnJo?q4s)tvx |~}`}b}dy~fn~gc~iW~kL~mA~o6q*rtv y}{e{g|hx|jm|kb|mW}nL}p@}q5~s*~u~v~x {~ykylzmxzol{pa{qV{rK|s@|u5}v*}w}x~z |~wpxqxrwyslytazuVzvJ{v?{w4|x)|y}z}{ }uuvvvvvwwkxx`xxUyyJyy?zz4{{){{||}} ~~t{u{u|uv|jw|_w|Tx}Iy}>z}3z~({~|~}~ ~rstttiu^vTwIx>x3y(z{| ~qr~sstit^uSvHw=x2y'zz| ~op~qsris^tSuHv=w2x'yz{ ~no}psqhr]sRtGu=v2w'xy{ }mn}orpgq\rRtGu<v1w'xy{ }lm}nrogq\rRsGt<u1v'xy{ }kl|mqofp\qQrFs<u1v&wx{ }kl|mqofp\qQrFs<u1v&wx{ }jk|mqnfo\pQrFs<t1u&wxz }ij{lpmfn[pPqFr;t0u&vxz }`b}dsfhg]iRkGm=o2q'rtv z}eg}hrjgk\mRnGp<q1s'uvx {~~j~k|~mq~nf~o\pQrFs<t1u&wxy |~|o|p{|qp}rf}s[}tP}uF~v;~w0~x&~yz{ }ztzuz{uo{ve{wZ|wP|xE|y;}z0}z%}{~|~| ~yyyyyzznzzd{{Y{{O{{D||:||/}}%}}}}~~ w~x~xx~ny~cy~YzNzD{9{/|%|}~ vwwwmxbxXyNyCz9{.{$||~uvwvmwbxXxNyCy9z.{${|}~stvulubvWwMwCx8y.z${{}~rsutktauWvLwBx8x.y#z{}~qrusktatWuLvBw8x.y#zz|~qrusjt`tVuLvAw7x-y#z{|~pqurjs`tVuLvAv7w-x#yz|~opuqjr`sVtLuAv7w-x#yz|~o~ptqjr_sUtKuAv7w-x"yz|~`bwdmfbgXiNkCm9o.q$rtvz}eguhkjakWmLnBp8q.s#uvx{~jkumjn`oVpLrAs7t-u#wxz|~o~ptqjr_sUtKuAv7w-x"yz{}s}tsuiu_vTwJw@x6y,z"z{|~~x|~xr~yh~y^~zTzJ{@{6|,|"}}~|}||}r|}h}~^}~T}~J}~@~~6~~,~"~~{{{q|g|]|S|I}?}5}+~!~~zzzp{f{\{R|H|>|5}+}!}~yyyozez\{R{H{>|4|*} }} ~xyxoyey\zRzH{>{4|*| }} ~wxxnxey[yQzGz={3{*| |} ~vxwnwex[xQyGy=z3{*{ || ~uwvmvdwZxPxFy=y3z){{| ~uwvmvdwZxPxFy=y3z){{| ~twumudvZwPwFx=y3z)z{{ }_zapcfe\gRhHj>l5n+p!rtvz}dyfogei\jRlHn>o4q*r tv x|~ixjnlem[nQpGq=r3t*u vx z|~nwompdqZrPsFt=u3v)wxy {}svtmucuYvPwFw<x2y)zz{ }~wuxlxbyXyOzEz;{2{(||} ~~{t{k|a|X|N|D};}1}(~~~ }sj`WMD:1' }sj`WMD:1' |~s~i~`~V~MC:0' {}r}h}_~U~L~C~9~0~& {|r|h|_}U}L}C}9~0~&~~ {{r{h|_|U|L|C}9}0}&~~~ z{q{g|^|U|K|B}9}/}&~~~ zzqzg{^{U{K|B|9|/}&}}~ yzpzf{]{T{K|A|8|/}%}}~ }_sajc`eWgMhDj:l1n'prt w{~|dsfig`iVjMlCn:o0q'stv x|~{irjhl_mUnLpCq9r0t&uvx z}zmqngo^pUqKrBt9u/v&wxy {}yrpsft]tTuKvAw8x/x%yz{ }~xvowfw\xSxJyAy7z.{%{|| ~wznze{[{R{I|@|7|.}$}}~ v~m~d~[~R~H?6-$ vmd[RH?6-$ ulcZQH?6,# ulcZQH?6,# tkbYPG>5,# tkbYPG>5,# sjaXOF=4+" sjaXOF=4+" sjaXOF=4+" w_naec[eRgIh@j7l.n$prt w{~vdmfdg[iRjHl?n6o-q$rtv y|~uhlickZlQnHo?p6r,s#tvw z}tlkmbnYoPqGr>s5t,u#vxy {}sqjrasXtOtFu=v4w+x"yz{ }~ruiv`vWwNxFx=y4y+z"{{| ~qyhy_zVzN{E{<{3|*|!}}~ p|g|^|V}M}D};}3~*~!~~ of^ULC;2)  of^ULC;2)  ne]TKC:1)  ne]TKC:1)  md\SKB91(  md\SKB91(  lc[RJA90( lc[RJA90( q_ha_cVeNgEh<j3l*n!prt x{~pcge^fVhMjDk;m3o*p!rtv y|~ohfi^kUlLnCo;p2r)s tvw z}nlem]nToKqCr:s1t)u vwy |~mpdq\rSsKtBu9v1v(w xy{ }~ltcu[uRvJwAw9x0y(zz{| ~kwcxZxRyIyAz8z0{'{||} ~j{b{Y|Q|H|@|7}/}'}~~~iaXPG?7.&iaXPG?7.&h`WOG>6.% h`WOG>6.% g_VNF>5-% g_VNF>5-% f^VME=5-$ f^VME=5-$ k_caZcReIgAh8j0l'nprt x|~jcbeYfQhHj@k7m/o'prtvy|~igahXjPkGm?n7p.q&stuw{}hk`lWmOoGp>q6r.s%uvw y|~go_pVqNrFs>t5u-v%wxy z}~fs^tVuMuEv=w5w-x$yzz |~ev]wUwMxDx<y4y,z${{| }~ez]zU{M{D{<|4|,|$}}} ~d}\}T}L~D~<~3~+~#~ c[SKC;3+# c[SKC;3+# bZRJB:2*" bZRJB:2*" aYQIA91*" aYQIA91*" aYQIA91*" g__aVcNeFg>i5j-l%npr uy|~ec]eUfMhDj<k4m,o$prt vz}~dg\hTjLkDm<n3p+q#rtu x{}cj[kSmKnCo;p3r+s#tuw y|~bnZoRpJqBr:s2t*u"vwx z}~arYsQtItAu9v1w*x"xyz |~auYvQvIwAx9x1y*y"z{{ }~`yXyPzHzA{9{1{)|!|}} ~_|W|O|H}@}8}0}(~!~~~ ^VOG?70(  ^VOG?70(  ]UNF>7/' ]UNF>7/' \TME=6.' \TME=6.' \TME=6.' c_[aScKeCg;h3j+l#npr uy|~abYdQeIgAi9k1l*n"prs vz}~`fXhPiHjAl9m1o)p!rsu x{}_jWkOmHn@o8p0r(s!tuw y|~^mVnOoGp?q7r0t(u vwx z}~]qUrNsFt>t7u/v'wxyz |}\tTuMuEv=w6w.x'yzz{ }~\xTxMyEy=z6z.{'{||} ~[{S{L|D|=|5|.}&}}~~ Z}R}K}C~<~4~-~%~~ ZRKC<4-% YRJC;4,% YRJC;4,% XQIB:3,$ XQIB:3,$ XQIB:3,$ _^W`ObHd@f8h0j(l!npr uy|~^bVdOeGg?i7k0l(n prs vz}]fUgNiFj>l7m/o'prsu x{}\iTjMlEm=n6p.q'rtuv y|~[mSnLoDp=q5r.t&uvwx {}~ZpRqKrCs<t4u-v%vwxz |}YtRuJuCv;w4w,x%yzz{ }~XwQxIxBy:y3z,z${{|} ~WzPzH{A{:{2|+|$|}}~ W|P|H|A}:}2}+}$~~~ VOG@92*# VOG@92*# UNG?81*" UNG?81*" UNG?81*" TMF>70)" Z^R`KbCd<f4h-j%lnpr uy|~YbRdJeCg;i4k,l%nprt wz}XeQgIhBj:k3m,n$pqsu x{}WiPjHlAm:n2p+q$rtuw z|~VlOmGn@o9q2r*s#tuvx {}~UoNpGq?r8s1t*u"vwxy |}TrMsFt>t7u0v)w"xxy { }~SuLvEv>w7x/x(y!yz{ |}~RxKxDy=y6z/z({!{|| }~R{K{D|=|6|/|(}!}}~ ~Q}J}C}<~5~.~'~ ~~ PIB;4-& PIB;4-& PIB;4-& OHA:3-& OHA:3-& g\h^j`kbmdwnfjph^qjQrmDto7uq*wsxu{w~{ecgehfjhkjwmkjnm]poPqpCsr6tt*vuxw{y~}bidjelgminvkpilq\nrPptCru6sv)uxwyzz}}`pbqdrfsgtuiuikv\mvOowBqx6ry)tzv{z|}~^v`wbwdxfxuhyhjy[lzNn{Bp{5r|(s|u}z~}\|^|`|b}d}tf}gh}[j~Nm~Ao~5q~(suy}Z\^acseggZiMlAn4p(rty}XZ]_ardffYhMj@m4o'qty}VX[]~`rbeeYgLi@l3n'qsx}UWZ\~_raedYfLi@k3n'psx}TWY\}^qaecXfLh?k3m'prx|RUWZ}]p_dbXeKg?j3l&orx|QTVY}\p_daXdKg?i3l&orx|QTVY}\p_daXdKg?i3l&orx|PSVX|[p^caWcKf>i2l&nqx|ORUW|Zp]c`WcKf>h2k&nqx|l\m^n`ob~qdrrfeshYtjLum@vo3wq'yszu|w~|jckemfnh}ojppkdrmXsoKtp?ur3wt&xuyw|y~}gihjjlkm|mnpnpcpqWqrKst>tu2uv&wxxy{{~~eogphqjr{ksomtcnuVpvJqw>sx2uy%vzx{{|~~cuevfvhwzjxnkxbmyVoyJpz=r{1t{%u|w}{~~a{c{e|f|zh|mj|al}Um}Io}=q~1s~%u~v~ {~_aceygmhajUlIn<p0r$tv z}]_acxelg`iTkHm<o0q$su z}\^`bxdlf`hTkHm<o0q$su z}Z\^awcke_gSiGl<n0p$ru z}Y[]`vbkd_fSiGk;m/o#rt z}XZ]_vakd_fShGj;m/o#qt y}WY\^v`jc^eRhFj;l/o#qt y}VX[]v`jb^dRgFi;l/n#qt y}UWZ\v_ja^dRfFi;k/n#ps y}TWY\u^ia]cRfFh:k.m#ps y}q]r_satcwtekug_viSwkGxm<yo0zq${s{u }x|ncoepfqhvrjksk_tmSuoGvp;wr/xt#yuzw }y}limjnlomvqnjrp^sqRtrFut;vu/xv#yxzy }{~~jokpmqnruosipt]ruRsvFtw:ux.wy#xzy{ |}~~htiukulvtnwhow]pxQryEsz:tz.v{"w|y| |~~fzhzi{k{sl{hn|\o|Pp|Er}9s}-u}"v~x~ |~dfg~isjgl[nPoDq9r-t!vx {~cef}hrjfk[mOoDp8r-t!uw {~ace}fqhfjZlOmCo8q,s!uw {~`bd|fpgeiYkNmCo7q,r tw {~^`b|dpfehYjNlCn7p,r tv {~]_a{cpedgYiMkBm7o+q sv {~\^`{bpddfYhMkBm7o+q sv {~\^`zbodcfXhMjBm6o+q sv {~[]_zaodcfXhMjBl6n+p rv {~Z\^zaocceXgMiBk6n+p rv z~v]w_wa}xcqxefygZyiOzkC{m8{o,|q!|s}u ~x|scteuf|uhpvjewkYwmNxoCyp7zr,{t {u|w ~z}qhriskztlotncuoXvpMwrBxs6yt+zv zw{y ~{~onpoqpyrqnsrctsWutLvuAwv6xw*yxzy{z }}~msntouxpumqvbrwWtwLux@vy5wz*xzy{{| }~kylymzxozlp{aq{Vr{Ks|@u|5v}*w}x}z~ }j~k~m~wn~lo~apVrJs?t4u)wxz }~hikwllnaoVpJr?s4t)vwy |~fhivkkl`mUoJp?r4s)uvy |~eghujjk_mTnIp>q3s(tvy |~dfguijj_lTnIo>q3s(tvy |~cefthij^kTmIo>p3r(tux |~bdetgii^kTlIn>p3r(sux |~ac~esfih^jSlHm=o2q'sux |~`b~dsfig^iSkHm=o2q'rtx {~`b}dsfhg]iRkGm=o2q'rtx |~z]z_{av{ck{e`|gU|iJ|k?}m4}o)}q~s~u y}xcxeyfuyhjzj_zkT{mI{o>|p3|r(}t}u~w z}vhwi~wksxlixn^yoSypHzr={s2{t'|v|w}y ~|~tmun}uosvphwq]wrRxtGyu=zv2zw'{x|y}z ~}~rsst}ttrtuguv\vwRwwGxx<xy1yz'zz{{|| ~~pxqx|ryqsyftz\uzQv{Fv{<w|1x|&y}z}|~ ~o}p}{q}pr~fs~[t~Pu~Fv~;w~0x&yz| ~mn{oppfq[rPtFu;v0w&xy{ }lmznooeqZrPsEt;u0v%wy{ }jkymnndoYpOrDs:t/u%wx{ }ijylnmdnYpOqDr:t/u%vxz }hixknlcnYoNpDr9s/t%vwz }ghxjnkcmYnNpDq9r/t%uwz }ghwjmkbmXnNpCq9r.t$uwz}fgwimjblXmNoCp9r.s$uvz}~egvhljbkWm}ICC_PROFILE MnCp8q.s$uvz}~]_zaoceeZgPiEk;m0o%qsu y}}b}dy}en~gd~iY~kO~lD~n:~p/r%suw {}{h{ix|kn|lc|nY|oN}pD}r9}s/~t%~v~wy |~ymynvzolzpb{qW{rM{tC|u8|v.}w$}x~y~z}wrxsuxtkytayuWzvLzwB{x8{x.|y#|z}{~|~uwvxuvxjwy`xyVxzLyzAy{7z{-{|#{||}}~t{u{uu|jv|`w|Vw|Lx}Ay}7z}-z~#{~|~}~r~sttjt_uUvKwAx7x-y"z{}~q}rssit_tTuJv@w6x,y"zz|~p|qrrhs^tTuJu@v6w,x"yz|~o|prqhr^sTtJu@v6w,x"yz|~n{oqpgq]rSsIt?u5v+w!xy|~m{nqogp]qSrIt?u5v+w!xy|~lzmpnfo\qRrHs>t5u+v!wy|~kzlpmfo\pRqHr>s5u+v!wx{}kzlpmfo\pRqHr>s5u+v!wx{}]}_saic_eTgJi@k6m,o"qsvz}b|drehg^iTkJl@n6p,r"suw{~g{hqjgk]mSnIp?q5r+t!uwy|~~lz~mp~nf~o\~qRrHs>t5u+v!xyz}|qy|ro|se}t\}tR}uH}v>~w4~x*~y ~z{ |~zuxzvn{ve{w[{xQ|xG|y=|y3}z*}{ ~{~| }~yzwyzmz{dz{Z{{P{|F{|=||3|})}}}}}~ ~w~vx~mx~cy~Yy~PzFz<{2{)||} ~vuwlwbxXxOyEy;z2{({|| ~uuvlvbwXxOxEy;y2z({{| ~~ttukuavXwNwDx;y1z(z{| }~sttktauXvNwDw;x1y(zz{ }~}rssjt`tWuMvDw:x1x'yz{ }~}qsrjs`tWtMuDv:w1x'yz{ }~}qsrjs`tWtMuDv:w1x'yz{ }~|psqir`sVtMuCv:v0w'xy{ }~]v_maccYePgFi<k2m)oqs vz}budlebgXiOkEl;n2p(rsu x{~~gthkjakXmNnDp;q1r(tuw y|~}ksljm`oWpMqDr:s1u'vwx z}|psqir`sVtMuCv:v0w'xyz |~{truhu_vUwLwCx9y0z&z{| }~z~yq~yg~z^~zU~{K{B{9|/|&}}} ~y}}p}}f}}]~~T~~K~~A~~8~~/~~% x{o{f|\|S|J|A}7}.}%~~~ xzozf{\{S{J|A|7|.}%}}~ wynyez[zR{I{@{7|.|$}}~ vxmxdy[yRzHz?{6{-|$|}} ~vwmxdx[yRyHz?z6{-{$||} ~vwmxdx[yRyHz?z6{-{$||} ~uvlwcwZxQxHy?y6z,{#{|} ~uulvcvZwQxHx?y6y,z#{{| ~y]p_fa]cTeKgAi8k/m%oqs v{~xbodfe\gSiJkAl7n.p%rsu x|~wfnhei[jRlIm@o7p.r$suv y|~vkmldm[oRpHq?r6s-u$vwx {}uolpcqZrQsHt?u6v,w#xyz |~tsktbuYuPvGw>w5x,y#z{{ }~swjxaxXyOyFz=z4{+{"||} ~r{i{`|W|N|F|=}4}+}"~~~ qh_VNE<3*! qh_VNE<3*! p~g~^~V~M~D;3*! p}g}^}V~M~D~;~3~*~! o|f|^|U}L}C};}2~)~ ~~ o|f|^|U}L}C};}2~)~ ~~ n{e{]|T|K|C|:}1})} ~~ n{e{]|T|K|C|:}1})} ~~ s]j_aaXcOeFg=i4k+m"oqs w{~raic`eWfNhFj=l4m+o"qsu x|~qfhh_iVjNlEm<o3p*r!suw z}~ojfk^mUnLoCp;r2s)t uwx {}nneo]pTqKrCs:t1u)v wxz |~mrds\tStKuBv9w1x(x yz{ }~mvdw\wSxKxBy9y1z({ {|} ~lzcz[{R{J{A|9|0|(}}}~ k}c}Z}R~I~A~8~0~'~ jbYQH@7/'jbYQH@7/'iaXPG?7.&iaXPG?7.&h`WOG>6.% h`WOG>6.% h`WOG>6.% m]d_\aScKeBg9i1k(m oqt w{~lacc[eRfJhAj9l0m(oqsu y|~kecgZhRjIkAm8n0p'qsuw z}~jibjYlQmHn@p7q/r'tuvx{}hm`nWoOpGq>r6t.u%vwx z|~hq`rWsOtGt>u6v.w%xyz {}~gu_vVvNwFx>x5y-y%z{{ }~fx^xVyMyEz=z5{-{$||} ~e|]|U|M}D}<}4},~$~~~ d\TLD<3+# d\TLD<3+# c[SKC;3+# c[SKC;3+# bZRJB:2*" bZRJB:2*" bZRJB:2*" h]`_WaOcGe>g6i.k%moq tx|~fa^cVeMfEh=j5l-m$oqs uy|~ee]gUhMjDk<m4n,p$qsu wz}di\jTlLmDn<p3q+r#tuv x{~cl[mSnKoCq;r3s+t#uvx z|~bpZqRrJsBt:u2v*v"wxy {}~atYuQuIvAw9w1x*y"zz{ }~`wXxPxHyAy9z1z){!{|| ~`zXzP{H{A{9|1|)|!}}~ ~_}W}O}H~@~8~0~(~!~ ^VOG?70(  ^VOG?70(  ]UNF>7/' ]UNF>7/' ]UNF>7/' \TME=6.' c\[^S`KbCd;f3h+j#moq tx|~b`ZbRdJfBg:i2k*m"oqr uy|~`dXfPgHiAj9l1n)o!qst wz}_hWiOkHl@n8o0p(r!stv x{~^lVmOnGo?q7r0s(t uvx z|~]oUpNqFr>s7t/u'vwxy {}~\sTtMuEu=v6w.w'xyz{ }~\vTwMwEx=x6y.y'z{{| }~[ySyLzDz={5{.{&||}} ~Z|R|K|C}<}4}-}%~~~ ZRKC<4-% YRJC;4,% YRJC;4,% XQIB:3,$ XQIB:3,$ WPHA:2+$ _\W^O`Hb@d8f0h(j!moq tx|~^`VbOdGf?g7i0k(m oqs vz|~\dTfMgEi=j6l.n'oqst w{}[gShLjDk=m5n.p&qrtv x{~ZkRlKmCo<p4q-r%suvw z|~YnRoJpCq;r4s,t%uvwy {}~XrQsItBt:u3v,w$xxyz |~XuQvIvBw:x3x,y$yz{| }~WxPxHyAy:z2z+{${||} ~V{O{G|@|9|2|*}#}}~~ U}N}G}?~8~1~*~"~~ UNG?81*" TMF>70)" TMF>70)" TMF>70)" SLE>7/(! [\S^L`Db=d5f.h&jmoq ty|~Z`RbKdCf<g4i-k%moqs vz}~YcReJfCh;j4k,m%oprt w{}XgQhIjBk:m3n,p$qstv y|~WjPkHmAn:o2p+r$stuw z|~VnOoGp@q9r2s*t#uvwy {}~UqNrGs?t8t1u*v"wxyz |~TtMuFu>v7w0w)x"yzz | }~SwLxEx>y7y/z(z!{{| }~SzLzE{>{7{/|(|!|}} ~R|K|D|=}6}/}(}!~~~ QJC<5.'  QJC<5.'  QJC<5.'  PIB;4-& PIB;4-& V\O^G`@b9d2f*h#jmoq uy|~U_NaGc?e8g1h*j"lnps vz}TcMeFf>h7j0k)m"opr t x{}SfLgEi>j7l/m(o!prs vy|~RiKjDl=m6n/p(q!rtu wz|~QmJnCo<p5q.r't uvw y{}~PpIqBr;s4t-u&vvwx z|~OsHtAt:u3v-w&wxyz {}~NuGv@v:w3x,x%yyz{ |~NxGx@y:y3z,z%{{|| }~M{F{?|9|2|+|$}}}~ ~L}E}?}8~1~*~$~~~ LE?81*$ KD>70*# KD>70*# KD>70*# eZg\h^jakcumehng[piNqkBsn5up(vrxt{w~{c`ebfdhfjgtkigmk[omNpoArq5tr(utwvzx~|`gbhdjfkgmrinfkpYmqMos@qt4ru'twvxzz}}^m`nbodp~fqrhrejtYluLnv@pw3rx'tyuzz|}~[s]t_uau}dvqfwehwXjxLly?nz3pz'r{t|y}}Yy[y]z`z}b{pd{df{Xi|Kk|?m}3o}&r}t~y}WY\^|`pcceWhKj>l2o&qsy}UXZ\{_oacdVfJi>k2n%psy}SVX[{]o`ccVeJh>j2m%orx|RUWZz]n_bbVeJg=j1m%orx|PSVXz[m^aaUcIf=i1l%nr x|ORUWzZm]a`UcIf=h1k%nq x|NQTWyZm\a_UbIe<h0k$nq x|MPSVyYm\a_UbId<g0j$mq x|LORUxXl[`^TaHd<g0j$mq x|KNQTxWlZ`]T`Hc<f0i$lq w|jZk\m^nazocnpebrgVsiJtk=un1wp%xryt|w~|g`hbjdkfzmgmniapkUqmIro=tq1ur%wtxv {y~}egghhjjkykmmmnanpUpqIqs<st0tu$vwxx {z~}cmenfohpxjqlkr`mtTouHpv<rw0tx$uywz {|~~`sbtdufuwgvkiw_kwSmxGoy<qz0rz$t{v| {}~^x`xbydyvfzkhz_j{Sl{Gn|;p|/r}#t}v~ z~}\~^~`~b~vd~jf^hRjFm;o/q#su z}Z\^aucie]gRiFk:n.p#ru z}Y[]`tbhd]fQiEk:m.o"ru z}WY\^s`hc\ePhEj9l-o"qt z}VX[]s`hb\ePgEi9l-n"qt y}TWY~\s^ga[cPfDh9k-m!pt y}SVX~[s]g`[cPeDh9j-m!os y}SVX}[r]f`[cOeDh8j-m!os y}RUW}Zr]f_[bOeDg8j-l!os y}QTV}Yq\f_ZaOdCg8i,l!os y}oZp\q^ratschte]ugQviEwk:xn.yp"zr{t }w|l`mbndofsqghri\skPtmEuo9vq-xr"ytzv }y~}jfkgmi}njrolfpm[roOspDtr8us-wu!xvyx |{~~hlimkn}loqnqforZpsOrtCsu8tv,vw!wyyz ||~~ergsht|jtpkuemvYnwNpxCqx7sy,uz v{x| |}~cwexfx{hypjydkzYmzMo{Bp{7r|+t| u}x} |~~a}c}e}zf~oh~cj~Xl~Mm~Bo~6q+s uw {~`bdyfngciWkLmAo6q*rtw {~^`bydnfchWjLlAn6p*rtw {~\^`xbmdbfWhLk@m5o*qsv {~[]_xaldafVhKj@l5n*prv {~Z\^xalcaeVgKi@l5n*prv {~Y[]w`lbadVfJi?k4m)orv z~XZ]w_laacVfJh?j4m)oqv z}WY\w^l`acVeJg?j4l)oqu z}VX[v]k``bUdJg?i4l)npu z}s[t]u_yuanvdcwfWwhLxjAyl6zn*zp{r|u ~x|q`rbsdxtfltgauiVvkKwm@xo5yq*zr{t|v ~y}ofphqiwrjlslatmVuoJvp?wr4xs)yuzv{x }{~llmmnnvookqq`rrUssJtt?uu4vv)xwyy{z }|~jqkrmsuntjot_puTrvIsw>tx3uy(wzxzz{ }}hviwkwtlxinx^oyTpyIrz>s{3t{(v|w|z} }~~g{h{~j|sk|im|^n|Sp}Hq}=s}2t~'u~w~y |~eg}hsjhk]mRnGp=q2s'uvy |~ce}frhgj\kRmGo<p1r'tuy |~bd}erggi\kRlGn<p1q'sux |~`b|dqffg\iQkFm<o1q&rtx |~_a|cqefg\iQjFl<n1p&rtx |~^`{bpdff[hPjFl;n0p&rsx {~]_{apcfe[gPiFk;m0o&qsw {~]_zaoceeZgPiEk;m0o%qsx {~\^z`obedZfPhEj;m0o%qsw {~x[x]}y_syahzd]zfR{hG{j=|l2|n'}p}r~u y}v`wb|wdqxffxg\yiQykFzm<{o1{q&|r|t}v z}sftg{uipujfvl[wmPwoFxp;yr0zs&zu{v}x ~{~qkrlzsmotoetpZuqPvrEws;xu0yv%zwzx|z ~|~oppqyqrnrsdstYtuOuvDvv:ww/xx%yyzz|{ ~}munvxovnpwcqxYrxNtyDuy9vz/w{%x{y|{} ~~lzmzwn{mo{bq{Xr|Ns|Ct|9u}.v}$w}y~{~}jkvmlnboWpMrCs8t.u$wx{}hivkllbnWoMpCr8s.t$vwz}ghujkkamWnLpBq8s.t#uwz}fhuijk`lVmLoAp7r-s#uvz}~eguhjj`kVmLnAp7q-s#uvz}~d~ftgji_jUlKnAo7q-r"tvz}~c~etfjh_jUkKmAo7p-r"tuy|~b~dtejg_iUkKlAn7p-r"suy|~a}cseif_hTjJl@m6o,q"suy|~}[}]v}_l~ab~dW~fM~hC~j8~l.n$pruy}z`zbu{dk{fa{gW|iL|kB|m8}o.}q#}r~tvz}xe~xgtyhjyj_zkUzmK{nA{p7|q-|s"}u}v~x{~vj}wkswmixn_xoTypJyr@zs6{t,{u"|w|x~z|~to|upruqhvr^wsTwtJxu@yv6zw,zx"{y|z}{}rt{suqtugtv]uwSvwIwx?xy5xz+yz!z{{|}}~~qyzrypszftz\t{Ru{Hv{>w|5x|+y}!z}{}}~~o}zp}pq}fr~\s~Rt~Hu~>v~5w~+x!yz|~nyoopeq\rRsHt>u4v*w xy |~lxmnneo[qQrGs=t3u*v wy |~kwlmmdoZpPqFr=s3u)vwy |~jwkmmdnZoPpFr=s3t)uwx {~ivjmlcmYnPpFq<r2t)uvx {~hvimkclYnPoFp<r2s)tvx {}hvimkclYnPoFp<r2s)tvx {}guhljbkXmOnEp;q2r(tuw {}[y]o_ea\dRfHh>j4l*n pr uz}`xbndef[gQiGk=m3o*q rt w{~}ew}gm}hd~jZ~kP~mF~n=~p3~q)suv x|~{jv{km|mc|nY|oP|pF}r<}s2}t)~u~w~x z}ynuyolzpbzqX{rO{sE{t;|u2|v(}w}x}y ~{}~wstxtkxuayuXyvNzwDzw;{x1{y(|z|z}{ ~}~}vwswxjwx`xyWxyMyzDyz:z{1{{'{|||}} ~~|t|su|iu|`v}Vw}Mw}Cx}:y~0y~'z~{~| ~{srthu_uUvLwCx9x0y&z{| }{qrrhs_tUtLuCv9w0x&yz{ }~zpqqgr^sUtKuBv9v/w&xy{ }~zoqpgq^rUsKtBu9v/w&xyz }~ynpofp]qTrKsAt8u/v%wxz }~ynpofp]qTrKsAt8u/v%wxz }~xmonfo\pSqJrAt7u.v%wxz |~xlomfn\oSqJrAs7t.u%vxz |~|[s]i_`aVdMfCh:j0l'npr vz}{`rbhd_fUgLiCk9m0o&qrt w{~zdqfgg^iUjKlBn9o/q&stv x|~yipjfl]mTnKpAq8r/t%uvx z}x~no~of~p\~qS~rJsAt7u.v%wxy |~w|rn|se|t[}tR}uI}v@}w7~x.~x$~y~z{ }~v{vm{wd|w[|xR|xH|y?}y6}z-}{$~{~|~| ~uyzlyzcz{Zz{Q{{H{|?{|6||,|}#}}}}~~ tx~kx~by~Yy~Pz~Gz>{5{,|#|}~ ~twkxbxYyPyGz>z5{,{#||} ~sujvavXwOxFx=y4y+z"{{} ~rtiu`uWvNwFw=x4y+y"z{| ~rtiu`uWvNwFw=x4y+y"z{| ~rsit`uWuNvFw=x4x+y"z{| ~qrhs_tVtNuEv<w3x*x!yz| ~qqhr_sVtNtEu<v3w*x!yz| }~v[m]d_[aRdHf?h6j-l$npr vz}t_kabcYePgGh>j5l,n#prt w{~sdjfagXiOjFl=n4o+q"rtv y|~rhii`kWlNnFo=p4r+s"tvw z}qmhn_oVpNqEr<t3u*v!wxy |~pqgr^sVtMtDu;v3w*x!yz{ }~oufv^vUwLxCx;y2y)z {{| ~n~ye~y]~zT~zK~{C{:{1|)| }}~ m}|d}|\}|S~}K~}B~}9~}1~~(~~ ~~ m{d{\|S|K|B|9}1}(} ~~ lzcz[{R{J{A|9|0|(}}~~ lycy[zRzJ{A{9{0|(|}}~ kycyZzRzI{A{8{0|'|}}~ kxcxZyRyIzAz8{0{'|||~ jwbxYxQyHy@z7z/{'{||~~jwbxYxQyHy@z7z/{'{||~~o[f]^_UaLdCf;h2j)l nps v{~n_ea]cTeKgCh:j1l)n prt x|~mcde\fShKjBk9m1o(p rtv y|~lhci[kRlJnAo9p0r(stvx {}klcmZnRoIqAr8s0t'uvxy |~jpbqYrQsHt@u7v/v'wxy{}~itauXuPvGw?w7x.y&zz{|~hw`xWxOyGy>z6z.{%{|| }~g{_{V|N|F|>|5}-}%}~~ f~^~V~M~E~=5-$ f^VME=5-$ e~]~U~M~D~<4,$ e~]~U~M~D~<4,$ }ICC_PROFILE d}\}T}L~D~<~3~+~#~ d|\|T|L}D}<}3}+~#~~~ d|\|T|L}D}<}3}+~#~~~ j[b]Y_QaHd@f7h/j'lnpsw{~h_`aWcOeGg>h6j.l%npr ux|~gc_eVfNhFj>k5m-o%prt vz}~fg^hVjMkEm=n5p-q$rtu x{}ek]lUmMoDp<q4r,s$uvw y|~do\pTqLrDs<t3u+v#wxy {}~cr[sStKtCu;v3w+x#xyz |}bvZwRwJxBx:y2y*z"{{| }~ayYyQzIzA{9{1{*|"|}} ~a}Y}Q}I~A~9~1~*~"~ `XPHA91)! _WOH@80(! _WOH@80(! _WOH@80(! ^VOG?70(  ^VOG?70(  dZ\\T^LaDc<e3g+i#knp sw{~c^[`SbKdCf;h3j+l#npr ty|~bbZdReJgBi:k2l*n"prs vz}~afYhQiIjAl9m1o*p"rsu x{}`jXkPmHnAo9p1r)s!tuw y|~_nWoOpHq@r8s0t(u!vwx {}~^qVrOsGt?t7u0v(w xyz |}]uUvNvFw>x7x/y'yz{| }~\xTxMyEy=z6z.{'{||} ~[{S{L|D|=|5|.}&}}~~ [~S~L~D~=~5.& ZRKC<4-% ZRKC<4-% YRJC;4,% YRJC;4,% XQIB:3,$ `ZX\P^HaAc9e1g)i!knp sx{~^^V`ObGd?f7h0j(l npr uy|~]bUdNeFg>i7k/l'nprs vz}\fThMiEj=l6m.o'prsu x{}[iSjLlDm=n5p.q&rtuw y|~ZmRnKoCp<q4r-t%uvwx {}~YpRqJrCs;t4u,v%vwxz |}XtQuIuBv:w3w,x$yzz{ }~WwPxHxAy:y2z+z${{|} ~VzOzG{@{9{2|*|#|}}~ V|O|G|@}9}2}*}#~~~ UNG?81*" UNG?81*" TMF>70)" TMF>70)" TMF>70)" \ZT\M^Ea=c6e.g'iknp tx|~Z^R`KbCd<f4h-j%lnpr uy|~YaRcJeCf;h4j,l%moqs vz}XeQgIhBj:k3m,n$pqsu x{}WiPjHlAm:n2p+q$rtuw z|~VlOmGn@o9q2r*s#tuvx {}~UoNpGq?r8s1t*u"vwxy |}TsMtFu>u7v0w)w"xyz { }~SvLwEw>x7x/y(y!z{{ |~RxKxDy=y6z/z({!{|| }~R{K{D|=|6|/|(}!}}~ ~Q}J}C}<~5~.~'~ ~~ QJC<5.'  PIB;4-& PIB;4-& OHA:3-& XZQ\I^Ba:c3e,g$iknp tx|~W]P_HaAc:e2g+i$kmor uy|~VaOcGe@f9h2j*l#moqs wz}TeMgFh>j7k0m)n"pqs u x{~ShLiEk>l7n/o(p!rst wz|~RkKlDm=o6p/q(r!suv x{}~QoJpCq<r5s.t'u vwx z|~QrJsCt<t5u.v'w xxy {}~PuIvBv;w4x-x&yyz{ |~OwHxAx:y3y-z&z{{| }~NzGz@{:{3{,|%||}} ~N|G|@|:}3},}%}~~~ M~F~?~9~2~+$ MF?92+$ MF?92+$ LE?81*$ SZL\E^>a7c/e(g!ikn quy|~R]K_Da=c6e/g(i!kmo rvz}~Q`JbCd<f5g.i'k moq sw{}OdHfAg:i3j-l&noqs uy|~NgGh@j:k3m,n%pqst wz|~MjFk?m9n2o+p$rstv x{}~LmEn?o8p1q*r$tuvw y|}KpDq>r7s0t*u#vvwy {}~KsDt>u7u0v*w#wxyz |}~JvCw=w6x0x)y"yz{| }~IxBx<y5y/z(z"{{|} ~~IzBz<{5{/{(|"||}} ~H|B|;|5}.}(}!}~~~ H~B~;~5~.~(! GA:4-'  GA:4-'  dXfZg]i_~jarldenfYohLqj@rm3to'vqwt{v~{a^c`ebfd}hfqjheljXmlLon?qp3sr'usvuzx}|^e`gbhdj|fkphmcjnWlpKnq>ps2ru&svuxzz}}[k]l_mao{dpofqchrVjsJlu>nv2pw%rxuyy{}~Yq[r]s`tzbtndubfvViwJkx=my1oz%r{t{y}}WwYx\x^yz`ymczaezUh{Ij{=l|1o|%q}t} y~}U}X}Z}\~y_~ma~ad~Uf~Ii~<k0n$ps y}RUWZx]l_`bTeHg<j0l$or y}QTVYw\k__aSdGg<i0l$or x}ORUWwZk]_`ScGf<h0k$nr x|MPSVvYk\__SbGd;g/j#mq x|LORUvXj[^^RaFd;g/j#mq x|KNQTvWjZ^]R`Fc;f/i#mq x|JMPSvVjZ^]R`Fc;f/i#lq x|ILORuViY]\R_Fb:e.i#lq x|HKNRuUiX][R_Fb:e.h#kp w|hXiZk]l_wnakod_pfSrhGsj<tm0vo$wqyt |w~|e^g`hbjdvkfkmh_njSplGqn;sp/ur#vsxu {x~|cdeffghivjjjkl^mnRooFpq;rs/tt#uvww {z~}`jbkdmfnugoiip]krRmsFot:qu.rw#txvy {{~~^p`qbrdstfthhu]jvQlvEnw:px.ry"tzv{ {}~\v^w`wbxsdxhfy\hyPkzEm{9o{-q|"s|u} z~}Z|\|^|~a}sc}ge}[g}Pi~Dk~9n~-p~!ru z}XZ]}_rafd[fOhDj8m-o!qt z}VX[}]q`fbZeOgCi8l,n!qt z}TWY|\p^eaYcNfCh7k,m pt y}SVX|[p]e`YcNeCh7j,m ot y}QTV{Yp\d_YaMdBg7i+l os y}PSV{Xp[d^YaMcBf7i+l ns y}ORUzWoZc]X`McBf6h+k ns y}NQTzWoZc\X_MbBe6h+k ns y}MPSyVnYc\W_LbAd6g*jms y}mXnZo]}p_qqafrdZtfOuhCvj8wm,xo!yqzt }w|j^k`mb|ndpofephYrjNslCtn7up,wr xszu |y~}hdifkg{lipnjdolYpnMroBsq7tr+vt wvyw |z~}ejgkhmyjnnkocmpWnrLpsAqt6su*twvxxy ||~~cpeqfrxhsmjtbkuWmvLov@pw5rx*tyuzx{ |}~aucvevxfwlhxajxVlyKmy@oz5q{*s{u|x} {~~_zazc{we{lg{ah|Vj|Jl|?n}4p})r}t~w~ {~]_awcleagViJk?m4o)qsw {~[]_vakd`fUhJj?l4n)prv {~Y[^u`jb_dTfIi>k3m(orv {~XZ]t_ia^dTfIh>j3m(oqv {~WY\t^i`^cTeIh>j3l(oqv z}VX~[s]i`^bSeHg=i2l'nqv z}UW~Zs\i_^aSdHf=i2k'npu z}TW~Ys\i^^aScHf=h2k'mpu z}SV}Xs[h]]`RcGe=h2j'mpu z}qYr[s]vt`ktb`udUvfJwi?xk4ym)zozr|t ~x|o^p`qburdjsf_thTujIvl>wn3xp(yrzt{u ~y}ldmfngtoiiqj^rlTsnIto>uq3vr(wtyv{w }{~jikj}mlsnmhon]ppRrqGsr=tt2uu'wvxxzy }|~hoip}kqrlrgns\otRpuGrv<sw1tx'vywzz{ }}~fthu|iuqjvflw\mwQoxFpy<rz1sz&u{v|y| |~~dyfy{gzpizfj{[l{Pn{Fo|;q|0r}&t}v}y~ |~b~d~ze~og~ei~ZkPlEn;p0q%suy |~`bzdofegZiPkEm;o0q%rtx |~_aycnedgYhOjDl:n/p%rtx |~]_xancceYgNiDk9m/o%qsx |~\^x`nbcdYfNhDj9m/o%qsx {~[]w_mabdXfNhCj9l.n$psw{~Z\w^mabcXeNgCi9k.n$prw{~Y[w^m`bbXdNgCi9k.m$orw{~XZv]l_baWdMfCh8j.m$orw{~vYw[zw]ox`exbZydPyfEzi;{k0{m%|o|r}t x|s^t`yubnuddvfYwhOwjDxl:yn/zp%zr{t}v ~z}qdrfxsgntictjYulNvnDwo9xq/yr%ztzv|x ~{~oipjvqllrmbsnWtpMuqCvr8wt.xu$yvzx|y~|~mnnouopkpqaqrWrsLttBuu8vv.ww#xxyy{{~}ksltumujou`pvVqwLrwAsx7uy-vz#wzx{{|}~ix~jxtlyjmy_nzUpzKq{Ar{7t|-u|"v}x}{~}g}~h}tj}jk~_m~Un~Kp~Aq~7s~-t"uwz}e}gshij_kTmJn@p6q,s"uvz}~d|frghi^jTlJn@o6q,r"tvz}~c{eqfgh]jSkIm?o5p+r!tvz}~a{cqegf]hSjIl?n5o+q!suy|~`zbpdff\gRiHk>m5o+q!ruy|~`zbpdff\gRiHk>m5o+q!ruy|~_zapcfe\gRiHj>l5n+p!rty|~^y`obed\fRhHj>l4n*p rt y|~zY}z[s{]i{`_{bT|dJ|f@|i6}k,}m"}o~rty}x^|x`rybhyd^zfTzhJ{j@{l6|n,|p"}r}t~vz}vc{weqwfgxh]xjSykIym?zo5{p+{r!|t|u~x{~thzuipukfvl\wnRwoHxp>yr5zs+zt!{v|w}y~|~rmysnotoetp\uqRvrHwt>xu4xv*yw zx{y }{~}prxqsnrtest[tuQuvGvw=vx3wx*xy yzz{ ||~~nwwoxmpxdqyZryPszFtz=u{3v{)w|x|y} |~~l{vm{mn|co|Yq|Pr|Fs}<t}2u})v~x~y~ |~kullmboXpOqEr;s2u(vwy |~~itjklamXnNpDq;r1t(uvx {~~htikkalXnNoDp;r1s(tvx {}}gshjj`kWmMnDp:q1s'tux {}}fshji`kWlMmDo:p1r'suw {}|esgih`jVkMmCn:p0q'stw {}|dsfig`iVjMlCn:o0q'rtw {}|cseif`hVjMkCm:o0p'rtw z}Yv[m]c`YbPdFf<i2k)mor uy}}^u}`l}bb~dX~fO~hE~j;~l2~n(prt v{}~zctzek{fa{hX{jN|kD|m;|o1}p(}r}t~u x|~|xhsxiiyk`ylVznMzoC{p:{r0|s'|t}v}w ~z}~{vlrwmhwn_xoUxqLyrCys9zt0{u&{v|x}y ~{}zuqqvrgvs^wtUxtKxuByv9yw/zx&{y{z|z ~|~ysuptvfuv]uwTvxKwxAxy8xy/yz%z{z{|| ~}yqzprzfs{]t{Tt{Ku|Av|8w|/x}%y}z}{~ }~xp~oq~fr~\s~St~JuAu7v.w%xy{ }~wnnoep[qRrIs@t7u.v$wxz }~vmmndo[pRqHr?t6u-v$wxz |~vlmmdn[oRqHr?s6t-u$vwz |~ukllcmZoQpHq?r6s,u#vwz |~ujlkcmZnQoHp?r6s,t#uwy |~ujlkcmZnQoHp?r6s,t#uwy |~tikjblYmPnGp>q5r,t#uvy |~yYp[f]]`TbKdAf8i/k%mor uz}x^o`fb\dSfJhAj7l.n%prt w{~wbndee[gRiIk@l7n.p$rsu x|~u}gl}hc}jZ~kQ~mH~n?~p6~q,~r#tuw z}~t{kk{lb|mY|oP|pG|q>}r5}s,}u#~v~w~x {}sypjyqazrXzsO{tF{u={v4|v+|w"}x}y~z |~rxtixu`yuWyvNzwFzw={x4{y+|z"|z}{~| }rvxiwx`wyWxyNxzFyz=y{4z{+{|"{||}}} ~~qu|hv|_v|Vw}Nx}Ex}<y}3y~*z~!{~{~} ~psgt^tVuMvDw;x3x*y!zz| ~orfs^tUtLuCv;w2x)x yz| ~oqfr^sUtLtCu;v2w)x yz| ~npeq]rTsKtCu:v1v)w xy{ }noep]qTrKsCt:u1v)w xy{ }~noep]qTrKsCt:u1v)w xy{ }~mndo\pSqKrBs9t1u(v wy{ }~rYi[`]W`NbFd=f4i+k"mor vz}q]h__aVcNeEg<i3k*m!oqs w{~pbgd^eVgMiDk;l3n*p!rsu y|~offh^iUjLlCm;o2p)r suw z}nkel]mToKpCq:r1s)u vwy {}m~od~p\~qS~rK~sBt9u1v(w xyz |~l|sc|t[|uR}uJ}vA}w9}w0~x(~y~z~z| }k{wc{xZ|xR|yI|yA|z8}z0}{'}{~|~|} ~jzzbzzY{{Q{{H{{@||7||/||'}}}}}}~~ix~ax~Xy~Py~Gz~?z7{.{&||}~iwaxXxPyGy?z7z.{&{||~hv`wWwOxGx>y6y.z%{{| }~hu`vWvOwGx>x6y.y%z{{ }~gt_uVuNvFw>w5x-y%zz{ }~gt_uVuNvFw>w5x-y%zz{ }~fs^tVtMuEv=w5w-x$yz{ }~lYc[[]R`JbAd9f0i(kmor v{~k]c_ZaRcIeAg8i0k'moqt x{~jabcYeQfHh@j7l/m'oqsuy|~ifagXiPjGl?m7o.p&rsuwz}gj_kVmNnFo>p5r-s%tuw y{~fn^oVpMqEr=s5t-u$vwx z|~er]sUtMtDu<v4w,x$xyz |}eu]vUvMwDx<x4y,y$z{{ }~d~y\~yT~zL~zD~{<{3{+|#|}} ~c}|[}|S}|K}}C~};~}3~}+~~#~~~~ b|Z|R|J}B}:}2}*~"~~~ b{Z{R|J|B|:|2}*}"}~~ azYzQ{I{A{9|1|*|"}}~ ayYyQzIzA{9{1{*|"|}} ~ayYyQzIzA{9{1{*|"|}} ~`xXxPyHyAz9z1{){!||} ~fY^[V]M`Eb=d5f-i$kmo rw{~e]]_UaMcDe<g4i,k$moq tx|~da\cTeLfDh<j3l+m#oqs vy|~ce[gShKjCk;m3n+p#qsu wz}biZjRlJmBn:p2q*r"tuv y|~amYnQoIpAq9r1t*u"vwx z|~`pXqPrHsAt9u1v)v!wxy {}~_tWuOuHv@w8w0x(y!zz{ }~^wVxOxGy?y7z0z({ {|| ~]zUzN{F{>{7|/|'|}}~ ~]}U}N}F~>~7~/~'~~ \TME=6.' \TME=6.' [~S~L~D~=~5.& [}S}L}D}=~5~.~&~~ Z}R}K}C~<~4~-~%~~ aXYZQ]I_Aa9d1f*h"jmo rw{~`\X^P`HbAd9f1h)j!moq tx|~_`WbOdHf@g8i0k(m!oqs vy|~]dUfNgFi>j7l/n'oqrt w{}\hTiMkEl=n6o.p'rstv y|~[lSmLnDo=q5r.s&tuvx z}~ZoRpKqCr<s4t-u%vwxy {}~YsRtJuCu;v4w,x%xyz{ }~YvRwJwCx;x4y,y%z{{| ~XyQyIzBz:{3{,{$||}} ~W|P|H|A}:}2}+}$~~~ W~P~H~A~:~2+$ VOG@92*# VOG@92*# UNG?81*" UNG?81*" ]XUZN]F_>a7d/f'hjmo sw{~[\S^L`Db=d5f.h&jmoq ty|~Z`RbKdCf<g4i-k%moqs vz}~YdRfJgCi;j4l,n%oqst x{}XgQhIjBk:m3n,p$qstv y|~WkPlHmAo:p2q+r$suvx z}~VnOoGp@q9r2s*t#uvwy {}~UqNrGs?t8t1u*v"wxyz |~TuMvFv>w7x0x)y"yz{ | }~SwLxEx>y7y/z(z!{{| }~SzLzE{>{7{/|(|!|}} ~R}K}D}=~6~/~(~!~~ QJC<5.'  QJC<5.'  QJC<5.'  PIB;4-& YXRZJ]C_;a4d,f%hjmo sx|~W\P^H`Ab:d2f+h$jmoq uy|~V`ObGd@f9g2i*k#moqs vz}UcNeGf?h8j1k*m"oprt x{}TgMhFj>k7m0n)p"qst v y|~SjLkEm>n7o/p(r!stu wz}~RmKnDo=p6q/r(t!uvw y{}~QpJqCr<s5t.u'v vwx z|~PsItBt;u4v-w&wxyz {}~OvHwAw:x3x-y&yz{{ }~NyGy@z:z3{,{%{||} ~N{G{@|:|3|,|%}}}~ ~M}F}?}9~2~+~$~~~ MF?92+$ MF?92+$ LE?81*$ UXNZG]?_8a1d*f"hjmp tx|~T\M^F`>b7d0f)h"kmo q uy|~S_LaEc>e7g/h(j!lnp svz}QcJeCf<h5j.k'm opr ux{}PfIhBi;j4l-m&oprt vy|~OiHjAl:m3n-p&qrtu wz}~NmGn@o:p3q,r%tuvw y|}MpFq?r9s2t+u$vvwx z|~LrEs?t8t1u*v$wxxy {}~LuEv?v8w1x*x$yyz{ |~K}ICC_PROFILE xDx>y7y0z*z#{{|| ~~JzCz={6{0{)|"||}} ~J|C|=|6}0})}"}~~~ J~C~=~6~0~)" IB<5/(" IB<5/(" PXIZB];_4a-d&fhjm pty|~O[H]A_:a3d-f&hjln quz|~N_Ga@c:e3g,h%jlnp sw{}LbEd?e8g1i*k$lnpr ux{}KeDg>h7j0k*m#npqs vy|~JhCi=k6l0n)o"prsu wz}~IkBl<m5o/p(q"rsuv y{}~HnBo;p5q.r(s!tuvx z|~GqAr:s4t-t'u vwxy {}~GtAu:u4v-w'w xyz{ |~Fv@w9w3x-x&y yz{| }~Ex?x8y2y,z%z{{| } ~Ez?z8{2{,{%|||} ~ ~D|>|8|1}+}%}}~~  D}>}8}1~+~%~~~~  C=70*$ bVdXe[g]|i`pkbcldWngKpi>rl2sn&uqws{v~{_\a^c`ebzgdnifbjhVljJnm=po1rq%tsvuzx}|\c^e`fbhzdjmfkahmUkoImp=or1qt%suuw zy}}Zi\j^lamycnmepagqUirIkt<nu0pv$rxty z{}~WoYp\q^rx`slct`euThvHjw<lx0oy$qzt{ y|}~UuWvZv\ww_xkax_dySfyGiz<k{0n{$p|s} y~}R{U{W|Z|v]|k_|_b}Se}Gg};j~/l~#o~r~ y}PSVXv[j^^aRcFf;i/l#nr x|NQTWuZi\]_RbFe:h.k#nr x|LORUtXh[]^QaEd:g.j"mq x|KNQTtWhZ]]Q`Ec:f.i"mq x|ILOSsVhY\\P_Eb9e-i"lq x|HKN~RsUgX[[P_Db9e-h!kq x|GJN~QsTgW[[P^Da9d-h!kp x|FIM~PsSgW[ZP]Da9d-g!kp w|EHL}OrSfV[YO]D`8d-g!jp w|gVhXj[k]um`inb]pdRqgFsi:tl.un#wqxs |v~{d\f^g`ibtjdhlf]nhQojEqm:ro.tq"vsxu {x~|acceeffhshjhjk\lmPmoEop9qr-st"uuww {z~}^i`jbl}dmrfnfhp[jqOlrDnt8pu-rv!txvy {{~~\n^o`p}bqqdrffsZhtOkuCmv8ow,qx!syvz z|}~Zt\u^u|avpcweewYgxNiyCkz7nz,p{ r|u| z~}WzYz\{{^{p`{dc|Ye|Mh|Bj}7l}+o} q~u~ z}UWZz\o_caXdMfBi6k+n pt z}SVXz[o]c`XcMeBh6j+m pt y}RUWyZn]c_WbLeAg6j*lot y}PSVxXm[b^WaLc@f5i*lns y}ORUxWmZb]W`Lc@f5h*kns y}MPSxVlYa\V_Ka@d5g*jms y}LORxUlXa[V^Ka@d5g*jms y}LORwUlXa[V^Ja?d4g)jms y}JMPwSlVaZV]J`?c4f)ils y}kWlYm\zo^op`cqcXreMshBuj6vl+wo xqzs }w|h]i_kaylcnnecogWpiLrkAsm6to*vqwsyu |y~}fbhdiexjglliamkVolKpn@rp5sr*usvuyw |z~}cheifkwhlljnakoVmpJor?ps4rt)tvuwxy |{~~ancoepvfqkhr`jsUltJmu?ov4qw)sxuyxz {}~^s`tbuudujfv_hwTjwIlx>ny3pz(qzs{w| {~~\x^x`ytbyidz^fzTh{Ij{>m|3o|(q}s}w~ {~Z}\}~^}sa~ic~^e~Sg~Hi~=l~2n'prv {~XZ}]s_ha]dRfGh=j2m'oqv {~WY}\s^h`]cReGh=j2l'oqv {~UW}Zr\g_\aRdGf<i1k'npv z}TW|Yq\f^\aQcFf<h1k&mpu z}SV|Xq[f]\`QcFe<h1j&mpu z}RU|WqZf]\_QbFe<g1j&lou z}QT{VpYf\[_PaFd;g0i&lou z}PS{VpXf[[^PaFc;f0i&lou z}pWqY~r\ss^it`^ucSveHvg=wj2xl'yozq|s ~w|m]n_}oaspchqe]rgRtiGuk=vm2wo'xqys{u }y}jbkd|meqngfoi\pkQrlFsn<tp1ur&wsxuzw }z}hhii{kkpllfnn[ooPppFrr;ss0tt&vvwwzy }|~~fmhnziookpelqZmrPotEpu;rv0sw%uxvyzz }}~cresyftnhtdjuYkvOmwDox:px/ry%tzu{y| |~~awcxxexnfychyYjzNlzDm{9o{/q|%s|u}y} |~_|a|wc|me}bg}Xh}Nj}Cl~9n~.p~$r~tx|~^`vbldbfWhMjCl8n.p$rtx|~\^v`lbbdWfMhCk8m.o$qsx|~[]u_kaadWfLhBj8l.n#psx{~Y[u]k`abWdLfBi8k.m#orw{~XZu]j_`aVdLfAh7j-m#orw{~WYu\j^``VcLeAh7j-l#orw{~V~Xt[j]_`UbKeAg7i-l"nqw{~U~WtZj\__UaKdAf7i-k"nqw{~tWuYwu\mv^bw`XwcNxeCyh9zj.zl${o|q}t~x|q\r^vs`ltbbtdWufMvhCwj8xm.yo$zq{s|u~y}obpduqekrgasiWtkLulBvn8wp.xr#yszu|w~{~mg~nhtojjpk_qmUrnKtpAuq7vs-wt"xuyw|y~|~kl}lmsmnioo_pqTqrJrs@st6uu,vv"wwxy{z}}hq|irrkshlt^ntTouJpv@rw6sx,ty"vzwz{|}~fv{hwqiwgjx]lxSmyIoy?pz5r{+s{!u|w|z}}e{zg{ph|fj|\k|Rm|Hn}>p}5q}+s~!u~v~z}czepffh\jRkHm>o5p+r!tvz}~aycoeef\hRjHl>m4o*q su y|~`xbndef[gQiGk=m3o*q ru y|~_xancee[gQhGj=l3n*p ru y|~]w_madcZePgFi=k3m)oqt y|~]w_madcZePgFi=k3m)oqt y|~\v^m`cbYdPfFh<k2m)oqt y|~[v]m_caYdPfFh<j2l)npt y|~yW{yYqz\gz^]{`S{cI{e?|g5|j+}l!}o}q~ty}v\yw^ow`exb\xdRyfHyh>zj4{m*{o |q|s ~uz}taxucnueevf[whQwjGxl=ym3zo*zq {s|u }w{~qfwrhmsidtkZtlPumFvo=wp3xr)yszu{v }y~|~okvplmqmcroYspPtqFur<vs2wu)xvywzx |z~}mpunqlorbpsXqtOruEtv;uv2vw(wxxyyz ||~~~kutlvkmvaowXpxNqxDry;ty1uz(v{w{y| |}~}jyskyjmz`nzWo{Mp{Dr{:s|1t|'u}w}y} {~~|h}si}ik}`l~Vn~Mo~Cp~:r~0s~'tvx {}{frhhi_kUlLmCo9p0r&sux {}{erghh_jUkLmCn9p0q&suw {}zdqfgg^iUjKlBn9o/q&rtw {}zcqegf^hUjKkBm9o/p&rtw {}ybpdfe]gTiKkAl8n/p%rsw z}yapcfe]fThKjAl8m/o%qsv z}x`obfd\fSgJiAk7m.o%qrv z}}}Ws}Yj}\`~^W~`M~cD~e:~g1~j'loq ty}|{\s{^i|``|bV|dM|fC}h:}j0}m'~o~q~s vz}{xarxchye_yfUzhLzjC{l9{m0|o&|q}s}u ~w{~zvfqwhgwi^xjUxlKymByo9zp/{r&{s|u}v ~y|~xtkoulfum\voSwpJwqAxr7ys.zu%zv{w|x ~{}wronspetq[trRusIvt@wu7xv.xw$yxzy{z }|~~vpsmqtdru[suRtvHuw?vw6vx-wy$xzyz{{ }}~~voxmpxdqy[ryRszHtz?u{6v{-w|$x|y}{} }~~um|ln|co|Zp}Qq}Hs}?t}6u~,v~#w~x~z |~tkklbmYoPpGq>r5s,u#vwz |~sjjkamXnOoFp=r4s+t"uwy |~sijjalXmOnFp=q4r+t"uvy |~rhii`kWlNnFo=p4r+s"tvy |~rgih`jWkNmFn=p4q+r"tuy |~rfih`iWkNlFm=o4p+r"suy |~qehg_hVjNkEm<n3p*q!sux {~vWmYd\[^R`Hc?e6h-j$loq uz}u\l^c`ZbQdHf?h6j,m#oqs v{~t}ak}cb}eY~fP~hG~j>~l5~m,~o#qsu x|~s{ej{ga|hX|jO|kF|m=}n4}p+}q"~s~u~v y|~ryjiyk`zmWznN{oF{p={r4|s+|t"}u}w~x {}pwngxo^xpVyqMyrDzs;zt3{u*{v!|w|x}z ~|~ourfvs^vtUwtLxuCxv;yw2yx)zx {y{z}{ ~}~osvftw^uwUuxLvxCwy;wy2xz)y{ z{z||} ~~nrzesz]t{Tt{Ku{Cv|:w|1x|)x} y}z}|~ ~mp~dq~\r~Ss~Kt~Bu9v1v(w xy{ }locp[qRrJsAt9u0v(wxy{ }lnco[pRqJrAs9t0u(vwx{ }~kmcnZoRpIqAr8t0u'vwx{ }~klcmZnRoIqAr8s0t'uvx{ }~klcmZnRoIqAr8s0t'uvx{ }~jkblYmQoHp@q7r/s'uvw{}~pWgY^\V^M`Dc;e3h*j!loq uz}n\e^]`TbKdCf:h1j)m oqs w{~m`db\dSfKgBi9k1m(o qru x|~lecg[hRjJkAm9n0p(qsuw z}~k}ic}jZ}lR~mI~nA~p8~q0~r'~tuvx {}j{mb{nY|oQ|pH|q@|r7}t/}u'}v~w~xz|~izqazrX{sP{tG{t?|u7|v.|w&}x}y}z~{}~hxu`xvWyvOywGzx>zx6{y.{y%|z|{}{ ~}~gwx_xxVxyNyyFyz>zz5z{-{{%{||||} ~~fu|^v|Vv|Mw}Ex}=x}5y}-y~$z~{~|~ }~ft^uVuMvEw=w5x-y$zz{ }~es]tUtMuDv<w4x,x$yz{ }~er]sUtMtDu<v4w,x$xy{ |~dq\rTsLtDt<u3v+w#xyz |~dq\rTsLtDt<u3v+w#xyz |~cp[qSrKsCt;u3u+v#wxz |~jWbYY\Q^H`@c7e/h'jloqvz}h[`]W_OaGd>f6h.j%lnp sw{~g`_bVdNfFg>i5k-m%oqr uy|~fd^fVgMiEj=l5n-o$qst wz}eh]iUkMlDn<o4p,r$stv x{}dl\mTnLoDq<r3s+t#uvw z|~c~p[~qS~rK~sC~t;u3v+v#wxy {}~b}sZ}tR}uJ~uB~v:~w2~w*~x"~y~z{ |~a{wY{xQ|xI|yA|y9|z1}z*}{"}{~|~| ~~`zzXzzP{{H{{A{{9||1||)||!}}}}~~ ~`y}Xy}Pz}Hz~A{~9{~1{~)|~!|~}} ~_xWxOyHy@z8z0{({!||} ~^wVxOxGy?y7z0z({ {|} ~^vVwOwGx?x7y0y(z {{| ~^uVvOvGw?x7x0y(y z{| ~~]uUvNvFw>x7x/y'yz{| ~~dW\YT\L^D`<c3e+h#jlo rv{~c[[]S_KaCd;f3h+j#lnp sx{~a_YaQcIeAg9h1j*l"npr uy|~`cXePfHhAj9k1m)o!prt wz}_gWhOjHk@m8n0p(q!rtv x{}^kVlOmGo?p7q0r(s uvw z|~]oUpNqFr>s7t/u'vwxy {}~\rTsMtEt=u6v.w'xxyz |~[uSvLvDw=x5x.y&yz{| }~Z~yR~yK~zC~z<~{4{-{%||}} ~Z}{R}{K}|C~|<~|4~|-~}%~}~}~~ Y|~R|~J|~C}~;}~4},}%~~~ Y{R{J|C|;|4|,}%}}~~ X{Q{I|B|:|3|,}$}}~~ XzQzI{B{:{3|,|$|}}~ WyPyHzAz:{2{+{$||}~ ~_WWYO\H^@`8c0e(h!jlo rw{~][U]N_Fa>d7f/h'jlnp tx|~\_TaMcEe=g6h.j'lnpr uy|~[cSeLfDh=j5k.m&oprt w{}ZfRhKiCj<l4n-o%prsu x{}YjRkJmCn;o4p,r%stuw z|~XmQnIoBp:q3r,t$uvwx {}~WqPrHsAt:t2u+v$wxyz |~VtOuGu@v9w2w*x#yzz{ }~UwNxGx?y8y1z*z"{{|} ~TzMzF{>{7{0|)|"|}} ~ T|M|F|>}7}0})}"~~~  SLE>7/(! SLE>7/(! S~L~E~>~7~/(! R~K~D~=~6~/(! ZWRYK\C^<`4c-e%gjlo sw{~Y[R]J_Ca;d4f,h%jlnq ty|~W^P`HbAd:f2h+j$lnpr vz}~VbOdGe@g9i2k*l#nprt w{}UfNhGi?j8l1m*o"prsv y|~TiMjFl>m7n0p)q"rtu w z|~SlLmEn>o7q/r(s!tuv x{}~RpKqDr=s6t/u(v!vwx z|~QsJtCu<u5v.w'w xyz {}~PvIwBw;x4x-y&yz{{ }~PxIxBy;y4z-z&{{|| }~O{H{A|:|3|-|&}}}~ ~O}H}A}:~3~-~&~~~ NG@:3,% NG@:3,% MF?92+$ VWOYG\@^9`2c*e#gjlo sx|~UZN\G^?a8c1e*g"iknp ty|~S^L`Eb>d7f/h(j!lnp rvz}RaKcDe=f6h/j(l!moq tw{}QeJgCh<j5k.m'n pqs uy|~PhIiBk;l4n-o&prst wz|~OlHmAn:o3q-r&stuv y{}~NoGp@q:r3s,t%uvwx z|~MrFs?t9t2u+v$wxxy {}~LtEu?u8v1w*w$xyzz |}~LwEx?x8y1y*z$z{{| }~KyDy>z7z0{*{#{||} ~J{C{=|6|0|)|"}}}~ J}C}=}6~0~)~"~~~ JC=60)" IB<5/(" SVLXE[>]7`/b(e!gil osx|~RZK\D^=a6c/e(g!ikn quy|~P]I_Ba;c4e-g&ikmo rvz}~OaHcAe:f3h-j&lmoq tx{}NdGf@g:i3j,l%noqs uy|~MhFi?k9l2n+o$prsu wz|~LkEl?m8o1p*q$rsuv x{}~KnDo>p7q0r*s#tuvx z|~JqCr=s6t0t)u"vwxy {}~IsBt<u5u/v(w"xxyz |}~HvBw;w5x.x(y!yz{| }~HxBx;y5y.z(z!{{|} ~~GzAz:{4{-{'| ||}~ ~G|A|:|4}-}'} }~~~ F}@}9}3~-~&~ ~~~ F@93-&  NVGX@[:]3`,b%dgil otx|~MYF[?]9`2b+d$fikm quy|~K]D_>a7c0e*g#ikmo swz}J`Cb=d6f0g)i"kmoq tx{}IcBe<f5h/j(k"mopr uy|~HgBh;j5k.m(n!pqst wz}~GjAk:m4n-o'p rstv y{}~Fl@m9n3o-q&r stuw y|}Eo?p8q2r,s%tuvw y {}~Dr>s8t1t+u%vwxy z |}~Ct=u7u0v*w$wxyz { }~Cv=w7w0x*x$yyz{ | }~Bx<x6y0y)z#z{{| }~Bz<z6{0{){#|||} ~~A{;{5|/|)|#|}}} ~A};}5}/~)~#~~~ aTcWeYf\zh^mjaalcUmfIoh=qk1sm%upvr {v~{^[`]b_daxfdlhf`jhTljHnl<pn0rp$srvu zw}|[a]c_eafwdhkfj_hlSjmGlo<nq0ps$ruuv zy}}XgZh]j_kvamkdn_fpShqGjs;mt/ou#qwtx yz}~UmWnZo\pv_qjar^dtRfuFiv;kw/nx#pysz y|}~SsVtXu[uu]vi`w]cwRexFhy:jz.mz#o{s| y}}PySyVzXzt[{h^{]a{Qc|Ef|:i}.l}"n}r~ y}NQTWsYh\\_PbEe9h-k"nr x}LOR~UsXg[[^PaDd9g-j!mr x|JMP}SrVfZ[]O`Dc8f-i!lq x|ILO}RrVfY[\O_Db8f-i!lq x|GJN}QqTfWZ[O^Ca8e,h!kq x|FIM}PqSfWZZO]Ca8d,g!kq x|EHL|OpSeVYYN]C`7d,g jq x|DGK|NpReUYYN\C`7c,f jp w|BFI{MpPdTYWM[B_7b+f ip w|eUgWhZ~j\sk_gma[ndPpfDqi9sk-un!vpxs |v~{b[d]e_}garidfkf[lhOnjDpl8rn-sp!urwu {x~|_aacce}efqghfijZjlOlmCno8pq,rs!tuvv {y~}]g_haj|ckpemegnYipNkqCms7ot,qu swvx {{~~Zm\n^o{appcqderYgtMiuBkv7nw+px ryuz z|}~XrZs]tz_toaucdvXfwMhxBjx6my+oz q{u| z}}UxWxZyy\yn_zcazWd{Lf{Ai|6k|*n}p}t~ z}S}V}X}x[~m]~b`~Wc~Le~@h~5j*mot z}QTVxYl\a_VaKd@g5i*lot y}ORUwWlZa]V`Jc?f4h)knt y}NQTvWkY`\U_Jb?e4h)knt y}LORvUkX`[U^Ja?d4g)jms y}KNQuTjW_ZT]I`>c3f(ims y}JMPuSjV_ZT]I`>c3f(ils y}ILOuSjV_YT\I_>b3f(ils y}HKNtRiU^XT[I_>b3e(hls y}jUkWmZxn\lo_apaVrdKsf@ti5uk*wnxpzs }w~|g[h]j_wkalmdanfVphJqj?rl4tn)upwryu |x~|dafcgevifkjh`ljUnlJom?qo4sq)tsvuyv |z~}agchejufkjhm_jnTlpImq>os3qt(suuwxx |{~~_lam~cnseoigq^hrSjsHlt=nu2pv'rwtyxz {|~~]r_s}atsctheu]gvRiwGkx=mx2oy'qzs{w| {~~Zw\x}^xraygcy\ezRgzGi{<l{1n|'p|r}w} {~X|Z|}]|r_}ga}\d}Rf}Gh~<j~1m~'o~qv {~VX|[q]f`\bQeFg<i1l&nqv {~UW{Zp\f_[aPdFf;i0k&npv {~SVzXo[e]Z`PcEe;h0j%mpv z}RUzWoZe]Z_PbEe;g0j%lou z}PSyVnXd[Y^OaDc:f/i%lou z}ORyUnWdZY]O`Dc:f/h%knu z}ORyUnWdZY]O`Dc:f/h%knu z}MPxSnVcYY\N_Db9d/g%jnu z}nUoW|pZqq\fr_\saQtdFuf<vi1wk&xnyp{s ~w|k[l]{m_poafpd[qfPrhFsj;ul0vn&wpxr{u }y}iajczleomfenhZpjPqlErm;to0uq%vsxuzw }z}ffhgyiinjjdllYmmOooDpp:rr/ss%uuvvzx }{~~dkflxgmniocjpYlqNnrDos9qu/sv%twvxyz ||~~aqcrveslftbhtWjuMlvCmw8ox.qy$szuzy||~~_vawvcwlexbgxWiyMjyClz8n{.p{$r|t|x}|~~]z_zua{kc{ae{Wg|}ICC_PROFILE Li|Bk|8m}.o}#q}s~x~|~[]u_ja`dVfLhAj7l-n#psx|~Z~\t^ja_cUeKgAi7l-n"psx{~X}Zs]i__aTdJf@h6j,m"orw{~W}Ys\i^_`TcJe@h6j,l"orw{~V|Xr[h]^`TbJe@g6i,l"nqw{~U|WrZh\^_TaJd@f6i,k"nqw{~T|WrYh\^^TaJc@f6h,k"mqw{~S{VqXg[]]S`Ic?e5h+j!mqw{~rVsXut[kt]au`WvbLwdBxg8xi.yl#zn{q}s~x|p[~q]tr_jsa_tdUufKvhAvj7wl-xn"ypzr|u~y}m`}nbsodipf_qgTriJtk@um6vo,wq"xryt|w~{}kf|lhrmihoj^plTqmJro@sp6ur,vs"wuxv{x~|~ik{jlqlmgmo]npSpqIqr?rs5tu+uv!vwxx{z}}fpzgqpirfjs\ltRmuHov>pv5rw+sx!uywzz|}~dtyfuogueiv\jwRlwHnx>oy4qz*sz t{v| z}}~byxdynezegz[i{Qk{Gl{=n|3p|*r} s}v} z~}~a}wc}me}df~Zh~Pj~Fl~=m~3o~)qsu z}~_vamcceYgPhFj<l2n)pru y|~]v_maccYePgFi<k2m)oqt y|~\u^l`bbXdOfEh;k2m(oqt y|~[u]l_baXdOfEh;j2l(npt y|~~Zt\k^aaXcNeDg;i1l(npt y|~~Yt[k^a`XbNdDg;i1k(mot x|~}XsZj]`_WaMdDf:h1j'mos x|~wVxxXnx[ey][y`QzbGzd={g3{i*|l |n}q ~ty}t[wu]mu_dvaZwdPwfFxh=yj3zl)zn{p{r }uz}r`vsbmtdctfYugPviFwk<xm2xo)yqzr{t }w~{~~petqgkrhasjXtkNumDvn;vp1wq(xsyuzv }y~|~}mjsnkjom`pnWqoMrpDtr:us1vt'wuxwzx |z~}|koslpimq`orVpsMqtCru:sv0uw'vxwyyz ||~~{isrjthlu_muUnvLpwCqw9rx0ty&uzvzy{ {}~~zgxqhxgjy^kyUmzKnzBp{9q{/r|&t|u}x} {~}zf|qh|gi|^k}Ul}Km}Bo}9p~/r~&s~u~x {}ydpffg]iTjKlAn8o/q%rtw {}xcoeff\hSjJkAm7o.p%rtw {}xaocfe\fShJjAl7m.o%qsw z}w`nbed[fRgIi@k7m.o$qrv z}w_naec[eRgIh@j7l.n$prv z}v_madc[eRgHh?j6l-n$prv z}v]m_da[cReHg?i6k-m$oqv z}{{Vr{Xh|[_|]U|`L|bC}d9}g0}i&~l~n~q ty}zy[qy]gz_^zaU{dK{fB{h9|j/|l&}n}p~r vz}xw`oxbfxd\yfSygJziAzk7{m.{o%|q|r}t ~w{~wtdnufeug[viRwjIwl@xn7yo.zq$zr{t|v ~y|~vrimsjdtl[tmRunHvp?wq6xr-xt$yuzv|x }z}upnlqocrpZsqQtrHus?vt6vu,wv#xwyx{z }|~~tnrkosbptYqtPruGsv>tw5ux,vx#wyxz{{ }}~~slvjmwanwXoxOqxFry=sy4tz+u{"v{x|z| |~~rkzilz`m{Wo{Np{Fq|=r|4s|+u}"v}w}z~ |~ri~ij~`l~Wm~Nn~Fp=q4r+t"uvy |~qhhi_kVlNnEo<p3r*s!tvy |~pfgh^iVkMlDm;o3p*r!tuy |~pegg^hVjMkDm;n3p*q!sux {~oefg^hUjLkCm;n2p)q suy |~odff^gUiLjCl;n2o)q rtx {~ocfe^fUhLjCk;m2o)p rtx {}tVkXb[Y]P`Gb>d5g,i#lnq uz}s}[j}]a}_X~aO~dF~f=~h4~j+~l"nps v{~q{_h{a_|cV|eN|gE|h<}j3}l*}n!~p~r~t x{~pydgyf^zgVziM{jD{l;{n3|o*|q!}r}t~v y|~owhfxi^xkUylLynCzo;zp2{r){s |t|v}w ~z}numevn]voTwpKxqCxr:yt1yu)zv {w{x}y ~|~msqdtr\tsSutKvtBwu9wv1xw(yx zy{z|{ ~}~lqucrv[svRtwJtxAux9vy0wy(xzy{z{|| ~~kpycqyZrzRszIt{Au{8v{0v|'w|x}y}|~ }kn|co|Zp|Rq}Ir}As}8t}0u~'v~w~x~{ }~jmbnYoQpHq@r7t/u'vwx{}~ilamXnPoGq?r7s.t&uvx{}~ikalXmPoGp?q7r.s&uvx{}~hj`kWmOnGo>p6r.s%tuw z}~hi`jWlOmGn>p6q.r%tuw z}~hh`iWkOlGn>o6p.r%stw z|~nVeX][T]K`Cb:d1g)i lnq uz}lZc\[^RaJcAe9g0i(knpr w{~k_caZcReIgAh8j0l'nprt x|~j}cb}eY}fQ~hH~j@~k7~m/~o'~prtvy|~i{ga{hX|jP|kG|m?|n7}p.}q&}s~t~uw{}hyl`ymWznOzoG{q>{r6{s.|t%|u}v}x ~y|~gxo_xpVyqNyrFzs>zt5{u-{v%|w|x}y ~z}~fvs^wtVwuMxuExv=yw5yw-zx${y{z|z }|~~etw]uxUuxMvyDwy<wz4xz,y{$z{z|{| }}~~dsz\tzTt{Lu{Dv{<w|3w|+x|#y}z}{} }~~cr}[s}St}Kt~Cu~;v~3w~+x~#x~y{ }~cp[qSrKsCt;u3u+v#wxz |~boZpRqJrBs:t2u*v"wxz |~boZpRqJrBs:t2u*v"wxz |~anYoQpIqAr9s1t*u"vwy |~amYnQoIpAq9r1t*u"vwy |}gV_XV[N]F`>b5d-g%iln qvz}fZ^\V^MaEc=e5g-i$knp sw{~e^]`UbMdDf<h4j,l$npr tx|~dc\eTfLhDj<k3m+o#prt vz}~bgZhRjJkBm:n2p*q"stu x{}a~jY~kQ~mI~nA~o9p1r*s"tuw y|~`|nX|oP|pH}qA}r9}s1}t)~u!~v~wx {}~_zrWzsO{tH{t@{u8|v0|w(|x!}x}y~z |~_yuWyvOzvHzw@{x8{x0{y(|y!|z}{}{ ~}~^xyVxyOyzGyz?z{7z{0{{({| |||}}} ~~]v|Uw|Nw|Fx}>x}7y}/y}'z~{~{~}~ ~]u~Uv~Nv~Fw~>x~7x/y'yz{| ~~\tTuMuEv=w6w.x'yzz| }~\sTtMtEu=v6w.w'xyz| }~[sStLtDu=v5w.x&xyz| }~[rSsLtDt=u5v.w&xxy{ }~bVZXR[J]B`:b2d*g"iln rv{~`ZX\P^HaAc9e1g)i!knp sx{~_^W`ObHd@f8h0j(l!npr uy|~^bVdOeGg?i7k0l(n prs vz}]fUgNiFj>l7m/o'prsu x{}\iTjMlEm=n6p.q'rtuv y|~[mSnLoDp=q5r.t&uvwx {}~ZqRrKsCt<t4u-v%wxyz |~Y}tR}uJ}uC~v;~w4~w,~x%~y~zz{ }~X|wQ|xI|xB}y:}y3}z,}z$~{~{~|} ~W{zP{zH|{A|{:|{2||+}|$}|}}~}~~ Wz}Pz}H{}A{~:{~2|~+|~$|~}~}~ VyOyGz@z9{2{*{#||}~ VxOxGy@y9z2z*{#{||} ~UwNxGx?y8y1z*z"{{|} ~UvNwGw?x8x1y*y"z{{} ~]VUXN[F]>`7b/d'giln rw{~[ZS\L^Da=c5e.g&iknp tx|~Z]R_KaCc<e4g-i%kmoq uy|~YaRcJeCf;h4j,l%moqs vz}WePgHhAj:k2m+n$pqsu x{}ViOjGl@m9n2p*q#rtuw z|~UlNmGn?o8q1r*s"tuvx {}~ToMpFq>r7s0t)u"vwx y |}TsMtFu>u7v0w)w"xyz { }~SvLwEw>x7x/y(y!z{{ |~RxKxDy=y6z/z({!{|| }~Q~{J~{C~|<~|5~|.|'} }}~ ~Q}}J}}C}}<~~5~~.~~'~~ ~~~~ P|I|B|;}4}-}&}~~~ P|I|B|;}4}-}&}~~~ P{I{B|;|4|-|&}}}~ ~XUQWIZB\:_3a,d$fikn rw{~WYP[H]A`:b2d+f$ikmp tx|~U]N_Ga?c8e1g*i"kmor uz|~TaMcFe>f7h0j)l"noq s w{}SdLfEg>i7j/l(n!oqr ux{}RhKiDk=l6n/o(p!rst wz|~QkJlCm<o5p.q'r suv x{}~PnIoBp;q4r-s&tuvw y|}OqHrAs:t3t-u&vwxy {}~NtGu@u:v3w,w%xyzz |}~MwFx?x9y2y+z$z{{| }~MyFy?z9z2{+{${||} ~L{E{?|8|1|*|$}}}~ ~L}E}?}8~1~*~$~~~ KD>70*# KD>70*# TUMWFZ>\7_0a)d"fik n sx{~SYL[E]>`7b/d(f!ikm pty|~Q\J^C`<b5d.f'h kmo ruz}~P`IbBd;f4g-i&kmoq sw{}OdHfAg:i3j-l&noqs uy|~NgGh@j:k3m,n%pqst wz|~MjFk?m9n2o+p$rstv x{}~LmEn?o8p1q*r$tuvw y|}KpDq>r7s0t*u#vvwy {}~JsCt=u6u0v)w"xxyz |}~IuBv<v5w/x(x"yyz{ }~IxBx<y5y/z(z"{{|} ~~HzBz;{5{.{(|!||}~ ~H|B|;|5}.}(}!}~~~ G}A}:}4~-~'~ ~~~ GA:4-'  QUJWCZ<\5_.a'd fik osx|~OYH[A]:`3b-d&fikm puy|~N\G^@`:b3d,f%hjmo rvz}~M`Fb?d9f2g+i$kmoq tw{}LcEe?f8h1j*k$mopr uy|~JfCh=i6j0l)m"oprt vz|~IiBj<l5m/n(p"qrtu x{}~HlBm;n5o.q(r!stuw y|}HoBp;q5r.s(t!uvwx z|~GrAs:t4t-u'v wxxz |}~Ft@u9u3v-w&w xyz{ |~Ew?x8x2y,y%zz{{ | }~Ey?y8z2z,{%{{|| } ~Dz>z8{1{+{%|||} ~ ~D|>|8|1}+}%}}~~  C~=~7~0~*~$  LUEW?Z8\1_*a$dfik osx|~KXDZ>]7_0a*d#fhjm puy|~I\B^<`5b/d(f"hjmo rvz}H_Ba;c5e.g(h!jlnq tx{}GbAd:e4g-i'k lnpr uy|~Ee?g8h2j,k%mnpq t wz|~Dh>i8k1l+n%oprs u x{}~Ck=l7m0o*p$qrsu w y|}Bn<o6p0q)r#stuv x{}~Bp<q6r0s)t#uvvw y{}~As;t5t/u)v#wwxy {|~@u:v4v.w(x"xyyz |}~@w:x4x.y(y"zz{{ }~?x9x3y-y'z!z{{| }~?z9z3{-{'{!|||} ~>|8|2|,}&} }}~~ _RaUcWeZvg]ki__jbSleGng;pj/rl#tovr {u}{[Y][_]a`udbifd]hfRjiFlk:nm.po#rrut zw}|X_Za]c_etaghdh]fjQhlEjn:mp.or"qttv zy}}UeWgZh\js_kham\dnPfpEiq9ks-nu"pvtx yz}}SkVlXm~[os]pg`q[crPesDhu9jv-mw!oxsy y|}~PqSrVs}Xtr[tf^u[avOcwDfx8iy-lz!nzs{ y}}MwPxSx}VyqYyf\zZ_zOb{Cd{8g|,j|!m}r} y~}K|N|Q||T}pW}eZ}Y]}N`~Cc~7f~,i~ mr x}ILO{RpVdYY\M_Bb7e+i lr x|GJNzQoTcWX[M^Ba6d+h kq x|EHLyOnScVWYL]A`6d*gjq x|DGKyNnRcUWYL\A`6c*fjq x|BFIxMmPbTWWL[@^5b*fiq x|AEHxLmObSWWLZ@^5b*eip x|@DGxKmObRWVLZ@]5a*eip w|?CFxJlNaRVUKY@]5a*dhp w|cSeVfX|h[pj]ek`YmcNoeCph7rj,tm uoxr {v~{`Yb[d]zf`ogbcidXkfMmiBok6qm+ro trwt {x~|]__aacycenegcghWijLklAmn6op*qrstvv {y~}Ze\g^hxajmckbemWgnLip@kq5ns*purvvx {{~~WjYk\mx^nl`oacpVerKhs@jt5lu*owqxuy z|}~UpWqZrv\sk_t`auUdvJfv?iw4kx)nypzu{ z}}RvUwWwuZxj]x__yTbyIez>g{3j{(l|o|t} z~}P{S{V|uX|j[|_^|Ta}Ic}>f}3i~(l~n~t~ z}NQTtWiZ^\T_Ib>e3h(knt y}LO~RsUiX^[S^Ha=d2g'jms y}JM}PsShV]ZR]G`=c2f'ims y}IL}OsRhV]YR\G_=b2e'ils y}GJ}NrQgT\WR[G^<a1d'hls y}FI}MrPgS\WRZG]<a1d'gks y}EH|LqOfS\VQYF]<`1d&gks y}DG|KqNfR\UQYF\<`1c&gkr y}gShVjXuk[jm]_n`TpcIqe>sh3tj(umwoyr |v~|dYf[~g]si`ijb^ldSnfHoi=qk2rm'tovryt |x~|b_da}ecsgehig]khRljGnl=pn2rp'srutxv |z~}_daf}cgreiggj\ilRjnGlo<nq1ps'rttvxw |{~~\j^k|`mqbnfdo\fpQhrFks<mt1ou&qwsxwy {|~~Zo\pz^qoarecsZetPguEiv;kw0nx%pyrzw{ {}~WtYuy\un^vd`wYcwOexDhy:jz/lz%o{q|w| {~~UyXyyZzn\zd_{Ya{Od{Df|:i|/k}%n}q}v~ {~S~V~xX~n[~c]~Y`NcDe9h/j%mpv {~QTwVmYb\X_NaCd9g.i$lovz}ORvUlWbZW]M`Cc8f.h$kouz}NQvTlWbZW\M_Cb8e.h$kouz}MPuSkVaYW\L_Bb8d.g#jnuz}LOuRkUaXW[L^Ba8d.g#jnuz}KNuQjT`WVZL]A`7c-f#jnuz}ILuOjS`VVYL\A_7b-e#imtz}lSmVynXno[dq]Yr`OscDte:uh/vj%xmyo{r }w|iYj[wl]mm`bnbXpdNqfCri9tk.um$voxrzt}y}f^h`viblkdblfWmhMojCpl8rn.sp$urvszv}z}ddffuggkiiajjWllLnnBoo8qq.rr#ttvvzx|{~~aicjueljfm`hnVjpLlqAmr7ot-qu#svuxyy||~~_n~aotcpjeq_grUisKjtAlu7nv-pw"rxtyy{|}~\s}^ts`uibu_dvTfwJhw@jx6my,oz"qzs{x||~~Zx|\xr^yhay^czTezJg{@i{6l|,n|"p}s}x~|~X}{Z}q]}g_~]a~Sd~If~?h~5j~+m!orx{~VzXp[f]\`RbHd>g5i+l!nrw{~UyWoZe\\_RaHd>f4i*k nr w{~SyVoXe[\]R`Hc>e4h*j mq w{~RxUnWeZ[]Q_Gb=d3g*j lq w{~QxTnVeY[\Q_Ga=d3g*i lq w{~PxSnVeX[[Q^Ga=c3f*i lp w{~OwRmUdWZZP]F`=c3f)hkp w{~pT|qWrrYhs\^t^TuaJuc@vf6wh,xk"ymzp|s~x|mY{n[qo]gp`]qbSrdItf?ui5vk+wm!xoyr|t~y}k^yl`ombeod\pfRqhHrj>sl4un*vp wrxt {v~z}hcxienkfelh[njQokGpm=ro3sp*tr vtwu {x}{~fhwhimikdjlZlnPnoFop=pr3rs)stuvww {y}|~cmvenmfochpYjqPkrFmt<ou2pv)rwtxvy z{}}arucsletbftXhuOjvElw;nx2ox(qyszv{ z|}~~~_wtaxkcxaeyXgyNizDjz;l{1n{(p|r|u} y~|~}]{s_{ja|`c|We|Mg|Di}:k}1m}'o~q~u~ y|~|[s]i_`aVdMfCh:j0l'npt y|~|Zs\i^`aVcMeCg:i0k'npt y|~{XrZh]__UaLcCf9h0j&mot y|~{WrYh\_^U`LcCe9h0j&los y|~zVqXg[^]U`KbBe9g/i&lns x|~zUqWgZ^\U_KaBd9f/i&kns x|~yTpWfY]\T^KaAc8f/h%kns x|~uTuvWlvYbw\Xx^OxaEyc;yf2zh({k{m|p ~sx|}rYss[jt]`t`WubMvdDwf:xi1xk'ymzo{r }u~z}|o^sp`iqb`rdVsfMthCuj:vl0wn'xpyrzs }v~{~{mcrnehof_phUqjLrkCtm9uo0vp&wrxtzu |x~|~zjhqkigmk^nlUonKpoBrp9sr/ts&utwvyw |z~}~yhlpimfkn]loTnqKorAps8rt/su%tvvxxy {{~}xfqohrfis\ktSltJmuAov7pw.rx%syuzx{ {|}~wdunfvegv[iwRjxIlx@ny7oy.qz$s{t{w| {~}vbymdydez[gzRi{Hk{?l{6n|-p|$r}s}w} {}u`}lb}cd}Zf~Qg~Hi~?k~6m~,o~#qrw z}t_kabcYePgGi>j5l,n#prw z}t^k`bbYdPfGh>j5l,n#prv z}s\j^a`XbOdFf=h4j+m"oqv z}s[j]a_XaOdFf=h4j+l"nqv z}~s[j]a_XaOdFf=h4j+l"nqv z}~rYi[`^W`NbFd=f4i+k"mpu z}~xyToyWfzY\z\S{^J{aA{c7|f.|h%}k}m~p ty}vvYmw[dw][x`RxbHyd?yf6zi-{k${m|o}r ~uz}ut^lu`cubZvdQwfHwh?xj6yl,zn#zp{r|t ~w{~tqbkrdbseYtgPtiGuk>vl5wn,xp#yrzs{u }x~|~rogiph`qjWrkNsmFtn=up4vq+ws"xtyu{w }z~}qmkhnl_omVpoNqpErq<tr3us*vu!wvxw{x }{~}pkpglq^mrVosMptDqu;rv3sv*uw!vxwyzz |}~~oitfju^luUmvLnwCpw;qx2ry)tz uzv{z| |}~ogxfhx^jyUkyLmzCnz;p{2q{)s| t|v}y} |~~ne|eg|]h|Tj}Kk}Cm}:n}1p~)q~ s~u~y |~mddf\gSiKjBl9n1o(q ruy |~mcde\fShKjBk9m1o(p rtx {~lacc[eRfJhAj9l0m(oqtx {}l`cb[dRfJgAi9k0m(oqsx {}k`cbZdRfIgAi8k0m'oqsx {}k_caZcReIgAh8j0l'npsx {}q}Th}W_}YV~\N~^E~a<~c3~f*~h!kmp ty}o{Yf{[^|]U|`L|bC|d;}f2}i)}k ~m~or vz}nx]ex_]yaTycKzeCzg:{i1{k)|m |o}q~s w{~mvbdwd\weSxgKxiByk9yl1zn({p {r|s}u ~y|~ltfcuh[uiRvjJwlAwm9xo0yp(yrzs{u}w ~z}krjcskZtmRtnIuoAvp8wr0xs'xtyuzw|x ~{}joobppYqqQrrHss@tt7uu/vv'wwxxyy{z}}~~inraosXptPqtGru?sv7tw.ux&vxwyyz{{}}~hlv`mwWnwOoxGqx>ry6sy.tz%u{v{x| {}}~~gjz_kzVm{Nn{Fo{>p|5r|-s|%t}u}w} {~}~fi}^j}Vl}Mm~En~=p~5q~-r~$t~uw z}~fh^iVkMlEn=o5p-r$stw z}~ef]hUiMkDl<n4o,p$rsv z|~ef]hUiMkDl<n4o,p$rsv z|~de\gThLjDk<m3n+p#qsv z|~dd\fTgLiDj<l3n+o#qrv y|~jTbWYYQ\H^@a7c/f'hkmpuz}iXaZX]P_Ga?d7f.h&jmorv{~h}]`}_W}aO}cG~e>~g6~i.~k%~moq tx|~fza^zcV{eM{fE{h=|j5|l-|m$}o}q~s ~uy|~exe]xgUyhMyjDzk<zm4{n,{p$|q|s}u }ICC_PROFILE ~wz}dvi\wjTwlLxmDxn<yp3yq+zr#{t{u|v ~x~{~ctm[unSuoKvpCwq;wr3xt+yu#zvzw|x }z~|~brqZsrRtsJttBut:vu2wv*xw"xxyy{z }|~}aquYrvQsvItwAtx9ux1vy*wy"xzy{{{ |}~~`oxXpxPqyHryAsz9tz1u{)v{!w|x|z} |~~`n{Xo{Pp|Hq|Ar|9s|1t})u}!v}w~z~ |~_l~Wm~On~Ho~@q~8r0s(t!uvy {}_kWlOmHo@p8q0r(s!uvy {}~^jVkOmGn?o7p0r(s tuy {}~^jVkOmGn?o7p0r(s tuy {}~]iUjNlFm>n7p/q'rtux {}~dT\WTYL\D^<a3c+f#hkm quz}cX[ZS]K_Ca;d3f+h#jmo rw{~b\Z^R`JbBd:f2h*j"moq tx|~`~`X~bP~dH~fA~g9i1k)m!oqr uy|~_|dW|fO|gH}i@}j8}l0}n(~o!~q~r~t wz}^zhVziO{kG{l?{n7|o0|p(|r }s}t~v y|~]ylUymNznFzo>{q7{r/{s'|t|u}v~x ~z|~\wpTxqMxrEys=yt6zu.zv'{v{w|x}y ~|}[usSvtLvuDwu=xv5xw.yw&yxzy{z|{ ~}~~ZtvRuwKuwCvx<wx4wy-xy%yzz{z{|| }}~~ZryRsyKtzCtz<u{4v{-w{%x|x|y}{} }~~Yq|Rr|Js|Ct};t}4u},v}%w~x~y~{ }~Xp~Qq~Ir~Bs~:t~3u,v$vwy{ }~XoQpIqBr:s3t,u$vwx{ }~XoQpIqBr:s3t,u$vwx{ }~WmPnHoAp:q2r+t$uvxz |~_TWWOYH\@^8a0c(f!hkm qv{}]XUZN]F_>a7d/f'hjmo sw{~\\T^M`Eb=d6f.h'jmoq ty|~[`SbLdDf=g5i.k&moqs vz}~YdRfJgCi;j4l,n%oqst x{}XgQhIjBk:m3n,p$qstv y|~W}kP}lH}mA~o:~p2~q+~r$~s~uvx z}~V{nO{oG|p@|q9|r2|s*}t#}u}v~w~y {}~UyrNysGzt?zt8{u1{v*{w"|x|x}y~{ }~UxuNxvGyv?yw8zx1zx*{y"{y|z|{~| ~}~TwxMxxFxy>yy7yz0zz)z{"{{{||| }} ~~SvzLwzEw{>x{7x{/y|(y|!z|{}|} }~~Su}Lv}Ev}>w~7x~/x~(y~!y~z~{ }~Rt~Ku~Du~=v~6w~/w(x!yy{ }~RsKtDt=u6v/w(w!xyz |~QrJsCt<t5u.v'w xxz |}~ZTRWKYC\<^4a-c%fhkn rw{~XXQZI]B_:a3c,f$hjmo sx|~W[P]H_Aa:d2f+h$jlnq ty|~U_NaGc?e8g1h*j"lnps vz}TcMeFf>h7j0k)m"opr t x{}SfLgEi>j7l/m(o!prs vy|~RjKkDm=n6o/p(r!stu wz}~QmJnCo<p5q.r't uvw y{}~P~pI~qB~r;~s4~t-u&vvwx z|~O|sH|tA|t:}u3}v-}w&}w~x~y~z {}~O{vH{wA|w:|x3|x-|y&}y}z}{~{ }~NzxGzx@{y:{y3{z,|z%|{|{}|~| ~}~My{Fy{?z|9z|2{|+{|${}|}|}}~ ~~Mx}Fx}?y}9y~2z~+z~${~{~|~} ~Mw~Fx~?x~9y~2y~+z$z{{| ~~LvEw?w8x1x*y$yz{| }~USNVGX?[8]1`*c"ehjm rw{~TWMYF\>^7`0c)e"hjl o sx|~R[K]D_=a6d/f(h!jln quy|~Q_JaCc<e5g.h'j lnp swz}PbIdBe;g4i-k&lnpr tx{}NfGh@i:j3l,m%oprt vy|~MiFj?l9m2n+p$qrtu wz}~LlEm?n8o1q*r$stuw y{}LoEp?q8r1s*t$uvwx z|~KrDs>t7t0u*v#wxxz {}~JuCv=v6w0x)x"yyz{ }~I~wB~x<~x5~y/~y(z"z{{| }~I}yB}y<}z5~z/~{(~{"~{~|~|} ~H|{B|{;||5}|.}|(}|!}}~}~}~~ H{|B{|;||5|}.|}(|}!}}}~}~~~ GzAz:{4{-{'| ||}~ QSJVCX<[5].`'c ehj nrw{~PWIYB\;^4`-c&ehjl ptx|~NZG\@^:a3c,e%gikn quy|~M^F`?b9d2f+h$jlnp swz}LaEc?e8f1h*j$lmoq tx{}KeDg>h7j0k*m#npqs vy|~IhBi<k5l/n(o"prsu wz}~HkBl;m5o.p(q!rsuv y{}~GnAo:p4q-r's tuvx z|~GqAr:s4t-t'u vwxy {}~Fs@t9u3u-v&w wxyz |}Ev?w8w2x,x%yyz{ | }~Ex?x8y2y,z%z{{| } ~Dy>y8z1z+{%{{|| } ~D{>{8|1|+|%|}}} ~ C~}=~}7~}0~~*~~$~~~~  NSGV@X:[3],`%cehj nsx{~LWEY?\8^1`*c$ehjl pty|~KZD\>^7a0c*e#gikn quz}~J^C`=b6d0f)h"jlnp sw{}HaBc;e5f.h(j!lmor ux{}GdAf:g4i-j'l noqs vy|~Fg@h9j3k-m&n pqsu wz}~Ej?k8m2n,o%prst v y{}~Dm>n8o1p+q%rtuv x z|~Cp=q7r0s*t$uvvw y {}~Cr=s7t0t*u$vwxy z |}~Bt<u6u0v)w#wxyz {}~Av;w5w/x)x#yyz{ |}~Ax;x5y/y)z#z{{| }~@y:y4z.z({"{{|| }~@{:{4|.|(|"|}}~ ~ISBV<X5[/](`"cehk osx|~HVBX;[5].`(b!dgil pty|~FY@[9]3`-b&d fikn qvz}~E]?_8a2c,e%gikm p sw{}C`=b7d0f*g$ikmo q uy|~Bc<e6f0h)j#kmop svz|~Af;g5i/j)l#mopr ux{}~@i:j4l.m(n"pqrt vy{}?k9l3m-o'p!qrsu wz|~>n8o2p,q&r stuw y{}~=p7q1r+s&t uvvx z|}~=r7s1t+t&u vwxy {|~<t6u0u+v%wwxyz |}~<v6w0w+x%xyyz{ |~~;w5x0x*y$yzz{| }~;y5y0z*z${{{|} ~~mft2!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!    !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!  ڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡڐCCkkҎIIqq̍NNxxƋSS~~YY]]bbffkkoorruuwwyy{{||ġҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡҡܓ??iiԑDDoo͏JJuuǎOO{{ŒTTYY^^bbffjjnnpprrsstt{{ߖ::ff֔@@llϒEErrʑJJxxďOO~~TTXX\\``ccffhhiippvv{{♙55cc٘;;iiҖ@@oo̕DDuuƓIIzzMMQQTTWWYY[[bbkkrrww{{枞//__ݜ44ee՛99kkϚ==ppʙAAuuĘDDzzGGJJKKKKYYddmmsswwzz꣣))[[ᡡ--aa٠11ffӠ55kk͠88ppȠ::ttá;;xx<<||@@OO[[eemmsswwzz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~﨨""VV樨%%[[ާ((aaب++eeҩ,,ii̫--mmȮ,,pp33wwDDQQ\\eellqqvvyy}}}}}}}}}}}}}}}}}}}}}}}}}}}}}}}}}}LLPPUU WW!!VV!!QQ((ff77wwFFRR\\ddkkppttww||||||||||||||||||||||||||||||||||((==((??))??++==//88''FF))kk99wwGGSS\\cciinnrrvvzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz//--11--55++??((33--##KK++mm;;vvHH~~RR[[bbggllppttyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy00$$44"";;BB7711!!OO--ll;;uuGG||QQYY``eejjnnrrwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww//55<<AA""3355""TT..kk<>iiEEkkKKll~~PPmmyyUUllssYYjjll^^hheeccee``jjcc``jjcc``jjcc``jjcc``jjcc``jjcc``jjcc``jjcc``jjcc``jjcc``jjcc``jjcc``jjcc``jjcc``jjcc``jjcc``jjcc덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv덍@@aaFFhh؉KKnnшQQttˇVVzzŅ[[__ddhhllppttww}}yy}}||{{yyvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv퐐<<__⎎AAffڌGGllҋMMss̉RRyyƈWW~~\\aaffjjnnrruuxx~~zz||~~zzxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx44ZZ瓓::bbݑAAiiՏFFoo΍LLuuȌQQ{{ÊWW\\``eeiimmqqttvvxx~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~//WWꗗ55__<>qqɘBBvvØEE{{IIKKLLTTaakkrrxx~~MM##SS줤((ZZᢢ,,``ڡ00ffҡ44kk̡77ppǡ99uu£::yy::~~JJXXbbkkrrxx}}FFMMTT竫""ZZޫ%%__׫''ddѬ))ii̱))ll..ss??~~MMYYccjjqqvv||((99&&??##DD!!GG!!II""JJ%%HH$$ZZ22ssBB}}OOZZbbiioouuzz..,,--..--11..22001199....==&&aa55ssCC{{OOYYaahhnnssyy}}}}}}}}}}}}}}}}}}}}}}}}}}}}}}}}..$$00%%11%%66$$>>""44(())CC''ee66rrDDyyOOXX``ffkkqqww||||||||||||||||||||||||||||||||++,,2299@@@@++&&GG((gg77ppDDwwNN||WW^^ddiioo||uuzz{{zz{{zz{{zz{{zz{{zz{{zz{{zz{{zz{{zz{{zz{{zz{{zz{{zz{{zz{{zz{{((,,2299??;;..$$JJ))ff77nnCCttMMyyUU||\\~~bbgg||mm~~wwss}}uuyy}}uuyy}}uuyy}}uuyy}}uuyy}}uuyy}}uuyy}}uuyy}}uuyy}}uuyy}}uuyy}}uuyy}}uuyy}}uuyy}}uuyy}}uuyy}}$$** .. 99?? 8800""KK))dd66kkBBqqKKuuSSxxYYzz__zz}}eezzwwjjxxrrqqwwppwwwwppwwwwppwwwwppwwwwppwwwwppwwwwppwwwwppwwwwppwwwwppwwwwppwwwwppwwwwppwwwwppwwwwppwwwwppwwww!! $$// 99??""5522""KK))aa55hh@@mmIIqqPPssWWuu~~\\uuxxbbttrrhhrrllooqqkkuuqqkkuuqqkkuuqqkkuuqqkkuuqqkkuuqqkkuuqqkkuuqqkkuuqqkkuuqqkkuuqqkkuuqqkkuuqqkkuuqqkkuuqqkkuuqq!!00 99??##5533""KK((__44ee>>iiFFmmMMooTTooyyZZooss__nnlleellggmmjjeesskkeesskkeesskkeesskkeesskkeesskkeesskkeesskkeesskkeesskkeesskkeesskkeesskkeesskkeesskkeesskk""11 ::??$$4433##II''\\22aa;;eeDDhhJJjjzzQQjjttVViinn\\hhggbbffaakkdd__qqdd__qqdd__qqdd__qqdd__qqdd__qqdd__qqdd__qqdd__qqdd__qqdd__qqdd__qqdd__qqdd__qqdd__qqdd__qqdd$$22::??$$5522%%GG%%XX00^^99aa@@cc{{GGddvvMMddooSScchhYYbbaa____[[hh]]ZZoo^^ZZoo^^ZZoo^^ZZoo^^ZZoo^^ZZoo^^ZZoo^^ZZoo^^ZZoo^^ZZoo^^ZZoo^^ZZoo^^ZZoo^^ZZoo^^ZZoo^^ZZoo^^&&33;;??$$6611''EE##UU--ZZ66]]}}==^^wwDD__qqJJ__jjPP]]ccVV[[[[\\XXVVeeVVTTllWWTTllWWTTllWWTTllWWTTllWWTTllWWTTllWWTTllWWTTllWWTTllWWTTllWWTTllWWTTllWWTTllWWTTllWWTTllWW<>ffؐDDmmюJJssʌOOyyċUUZZ^^ccggllooss}}}}}}}}}}}}}}}}}}}}}}}}}}}}}}}}%%GG&&MM,,TT22\\䖖88ccڔ>>iiӓCCpp̑IIvvƐNN||SSWW[[^^aaccoo""DD##JJ%%PP++WW眜11__ݚ66eeՙ;;llΗ@@rrȗDDxx–II}}LLNNOO\\hhss}}##??GGLL##SS죣((ZZ⢢--``١11ffѠ55llˠ88rrš::ww;;||EESS``jjss||((33%%<>&&BB&&CC((CC##KK,,oo==yyKKWWaaiiqqyy++##--&&//((11**33++66++@@))5533""UU00nn??wwLL~~WW``hhooww~~||||||||||||||||||||||||||||||))++--..44==BB$$00::$$ZZ22mm@@uuLL{{VV^^ffmm}}vvyyxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx&&(())//66>>AA''-->>%%^^22kk@@rrKKwwTT{{]]~~dd}}kkxxtt~~tt}}ssssssssssssssssssssssssssssss""##''-- 66==AA))**AA%%^^22hh??ooJJssSSww[[yybbyyxxiiyyssrrxxoo||yynnyynnyynnyynnyynnyynnyynnyynnyynnyynnyynnyynnyynnyynnyynnyy  ##))66==AA++))BB$$]]22ee>>kkHHooPPrrXXsszz__ttssggssnnpprrjjzzssii~~ssii~~ssii~~ssii~~ssii~~ssii~~ssii~~ssii~~ssii~~ssii~~ssii~~ssii~~ssii~~ssii~~ssii~~ss++ 66==>>,,))BB##[[11bb<>==,,**AA""XX//^^::ccCCff||KKhhvvSShhooZZhhhhbbffbbkkee__vvff^^zzff^^zzff^^zzff^^zzff^^zzff^^zzff^^zzff^^zzff^^zzff^^zzff^^zzff^^zzff^^zzff^^zzff^^zzff .. 88>> ==,,**@@!!TT--ZZ77^^~~@@aawwHHbbqqOObbjjWWaabb__``]]ii^^YYtt__XXxx``XXxx``XXxx``XXxx``XXxx``XXxx``XXxx``XXxx``XXxx``XXxx``XXxx``XXxx``XXxx``XXxx``XXxx``  // 88>> ??++,,==PP**VV44YYyy==[[rrEE\\llLL\\ddTT[[\\\\YYWWffXXSSrrYYRRvvYYRRvvYYRRvvYYRRvvYYRRvvYYRRvvYYRRvvYYRRvvYYRRvvYYRRvvYYRRvvYYRRvvYYRRvvYYRRvvYYRRvvYY""00 88== @@**//::!!KK''QQ{{11TTtt99VVmmAAVVffHHVV^^PPTTVVXXRRQQccPPMMppRRLLttRRLLttRRLLttRRLLttRRLLttRRLLttRRLLttRRLLttRRLLttRRLLttRRLLttRRLLttRRLLttRRLLttRRLLttRR##00 88==@@))2266%%FF}}%%MMvv--OOoo66PPhh==PP``EEOOYYMMNNRRVVKKNNbbJJJJnnKKHHrrKKHHrrKKHHrrKKHHrrKKHHrrKKHHrrKKHHrrKKHHrrKKHHrrKKHHrrKKHHrrKKHHrrKKHHrrKKHHrrKKHHrrKK::GG==MMBBSSGGYY~~MM__}}RRee||WWjjzz[[ooyy``ttxxddxxwwjj}}vvoouuttttyyrr~~ppnnjjffeeeeeeeeeeeeeeeeeeeeeeeeeeee::GG==MMBBSSGGYY~~MM__}}RRee||WWjjzz[[ooyy``ttxxddxxwwjj}}vvoouuttttyyrr~~ppnnjjffeeeeeeeeeeeeeeeeeeeeeeeeeeee::GG==MMBBSSGGYY~~MM__}}RRee||WWjjzz[[ooyy``ttxxddxxwwjj}}vvoouuttttyyrr~~ppnnjjffeeeeeeeeeeeeeeeeeeeeeeeeeeee::GG==MMBBSSGGYY~~MM__}}RRee||WWjjzz[[ooyy``ttxxddxxwwjj}}vvoouuttttyyrr~~ppnnjjffeeeeeeeeeeeeeeeeeeeeeeeeeeee::GG==MMBBSSGGYY~~MM__}}RRee||WWjjzz[[ooyy``ttxxddxxwwjj}}vvoouuttttyyrr~~ppnnjjffeeeeeeeeeeeeeeeeeeeeeeeeeeee::GG==MMBBSSGGYY~~MM__}}RRee||WWjjzz[[ooyy``ttxxddxxwwjj}}vvoouuttttyyrr~~ppnnjjffeeeeeeeeeeeeeeeeeeeeeeeeeeee::GG==MMBBSSGGYY~~MM__}}RRee||WWjjzz[[ooyy``ttxxddxxwwjj}}vvoouuttttyyrr~~ppnnjjffeeeeeeeeeeeeeeeeeeeeeeeeeeee::GG==MMBBSSGGYY~~MM__}}RRee||WWjjzz[[ooyy``ttxxddxxwwjj}}vvoouuttttyyrr~~ppnnjjffeeeeeeeeeeeeeeeeeeeeeeeeeeee::GG==MMBBSSGGYY~~MM__}}RRee||WWjjzz[[ooyy``ttxxddxxwwjj}}vvoouuttttyyrr~~ppnnjjffeeeeeeeeeeeeeeeeeeeeeeeeeeee::GG==MMBBSSGGYY~~MM__}}RRee||WWjjzz[[ooyy``ttxxddxxwwjj}}vvoouuttttyyrr~~ppnnjjffeeeeeeeeeeeeeeeeeeeeeeeeeeee::GG==MMBBSSGGYY~~MM__}}RRee||WWjjzz[[ooyy``ttxxddxxwwjj}}vvoouuttttyyrr~~ppnnjjffeeeeeeeeeeeeeeeeeeeeeeeeeeee::GG==MMBBSSGGYY~~LL__}}RRee||VVjj{{[[ooyy``ttxxddxxwwjj}}vvoouuttttyyrr~~ppnnjjffffffffffffffffffffffffffffff77FF99LL>>RRCCYYII__ꁁNNeeSSkk~~YYpp||]]uu{{bbzzzzff~~xxllwwqqvvwwtt||rrpplliiiiiiiiiiiiiiiiiiiiiiiiiiiiii33DD55JJ99PP??XXEE^^ꄄJJeeჃPPkkفUUppӀZZvv~~__{{}}dd{{iizzmmxxttvvzzttqqmmnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn//BB11HH33NN99UU??\\ꉉEEccKKii؅PPoo҄VVuû[[{{ǀ``ee}}jj{{ooyyuuvv}}ssoossrrrrrrrrrrrrrrrrrrrrrrrrrrrr**??,,EE..KK11RR88YY쎎>>``⌌DDggيJJnn҈PPtṫUUyyƅ[[``eejj~~oozzwwttttwwwwwwwwwwwwwwwwwwwwwwwwwwwwww%%;;''AA((GG))MM//TT55\\哓<>$$DD%%JJ((PP..XX癙44__ݗ::ffՕ??mmΔDDssȓIIyy’NNQQTTVVii~~)),,&&55!!@@ GG!!LL%%SS롡**ZZ៟//aa؟44hhО88nnɞ<>zz??NN]]kk{{**&&++++((22%%;; EEMMTT嫫""[[۫%%aaӭ((ggͳ))ll33vvDDRR``llyy)) ++$$--((--,,++11))77))<<((@@))AA++@@((gg88uuGG}}UU``llxx}}wwwwwwwwwwwwwwwwwwwwwwwwwwwwww''))++ --##//%%11''33''==''22++%%II**jj;;ssIIzzUU``kk~~vvyyttssssssssssssssssssssssssssss$$&&((**++11::AA8800 NN--hh<>YYmmGG[[ffQQ[[^^[[ZZXXggYYTTttZZPP[[PP[[PP[[PP[[PP[[PP[[PP[[PP[[PP[[PP[[PP[[PP[[PP[[PP[[PP[[++ 55<<??''4444%%FF~~&&NNww11RRoo::TThhDDTT``MMTTXXWWSSRRddRRNNrrSSJJTTJJTTJJTTJJTTJJTTJJTTJJTTJJTTJJTTJJTTJJTTJJTTJJTTJJTTJJTT ,, 66<<??&&6600))BBzz''JJrr//LLjj77NNbb@@NN[[JJMMSSUULLNNbbKKIIppLLEEMMEEMMEEMMEEMMEEMMEEMMEEMMEEMMEEMMEEMMEEMMEEMMEEMMEEMMEEMM,, 66;;>>$$99----<>##>>++2266tt))BBll11CCee99DD^^AACCWWKKBBPPUU@@LLaa>>GGnn@@CC{{@@CC{{@@CC{{@@CC{{@@CC{{@@CC{{@@CC{{@@CC{{@@CC{{@@CC{{@@CC{{@@CC{{@@CC{{@@CC{{@@CC{{@@;;::>>??@@DD}}CCIIzzGGNNvvMMTTuuRRYYssXX__rr^^ddqqddjjppjjnnnnoorrmmuuuullzzxxjjzzhh{{ee||aa||\\||YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{;;::>>??@@DD}}CCIIzzGGNNvvMMTTuuRRYYssXX__rr^^ddqqddjjppjjnnnnoorrmmuuuullzzxxjjzzhh{{ee||aa||\\||YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{;;::>>??@@DD}}CCIIzzGGNNvvMMTTuuRRYYssXX__rr^^ddqqddjjppjjnnnnoorrmmuuuullzzxxjjzzhh{{ee||aa||\\||YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{;;::>>??@@DD}}CCIIzzGGNNvvMMTTuuRRYYssXX__rr^^ddqqddjjppjjnnnnoorrmmuuuullzzxxjjzzhh{{ee||aa||\\||YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{;;::>>??@@DD}}CCIIzzGGNNvvMMTTuuRRYYssXX__rr^^ddqqddjjppjjnnnnoorrmmuuuullzzxxjjzzhh{{ee||aa||\\||YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{;;::>>??@@DD}}CCIIzzGGNNvvMMTTuuRRYYssXX__rr^^ddqqddjjppjjnnnnoorrmmuuuullzzxxjjzzhh{{ee||aa||\\||YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{;;::>>??@@DD}}CCIIzzGGNNvvMMTTuuRRYYssXX__rr^^ddqqddjjppjjnnnnoorrmmuuuullzzxxjjzzhh{{ee||aa||\\||YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{;;::>>??@@DD}}CCIIzzGGNNvvMMTTuuRRYYssXX__rr^^ddqqddjjppjjnnnnoorrmmuuuullzzxxjjzzhh{{ee||aa||\\||YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{;;::>>??@@DD}}CCIIzzGGNNvvMMTTuuRRYYssXX__rr^^ddqqddjjppjjnnnnoorrmmuuuullzzxxjjzzhh{{ee||aa||\\||YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{;;::>>??@@DD}}CCIIzzGGNNvvMMTTuuRRYYssXX__rr^^ddqqddjjppjjnnnnoorrmmuuuullzzxxjjzzhh{{ee||aa||\\||YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{YY{{99::<>DDAAJJ||EEOOyyKKUUwwPPZZvvUU``tt[[eessaajjrrggooppmmssoosswwmmxxzzll~~||ii~~ffbb^^~~[[~~[[~~[[~~[[~~[[~~[[~~[[~~[[~~[[~~[[~~[[~~[[~~[[~~[[~~669988??;;DD>>JJBBOO}}HHUU{{MM[[zzRRaaxxXXffvv]]kkttccppssjjuuqqppyyppvv||nn||kkhhdd__````````````````````````````228855>>77CC::II>>OODDUUII\\}}OOaa||TTggzzZZllxx__qqvveevvttll{{rrssppzznnjjffccffffffffffffffffffffffffffff//6611<<33BB66HH99MM??TTEE[[JJaa瀀PPgg~~VVmm||[[rrzzaawwxxgg||vvoossvvppllgghhkkkkkkkkkkkkkkkkkkkkkkkkkkkk**33--99//??11EE44KK88RR>>YYEE``慅KKff݃PPllׁVVrr\\xx}}bb}}zzhhwwqqss{{nniinnpppppppppppppppppppppppppppp&&00((66**<<,,BB..HH00OO77VV==]]拋CCdd݉IIkkևOOqqυUUwwʃ[[||ŀaa}}hhxxssssppttuuuuuuuuuuuuuuuuuuuuuuuuuuuu((''''..$$88&&>>''EE))KK,,QQ33YY铓99``ߑ??gg֏EEnnύKKttɌQQzzÊVV[[ll}}||||||||||||||||||||||||||||||''""))((((..$$::##AA##GG$$MM))UU뜜//\\ᚚ55ccי::jjϙ>>qqșBBwwEE~~NNff~~%%((""**''**--''55##??IIOO﨨""VV㨨&&]]ب**ddϪ,,kků,,rr>>||OObbyy}}##&&(( ++$$--)),,--**33))::''??''BB((CC##XX22qqDDyyTTddvvxxvvzzzzzzzzzzzzzzzzzzzzzzzzzzzz!!$$&&((++--""//$$11&&88&&DD&&-->>&&bb77ooGGvvVV{{dd~~zzuuttnnpppppppppppppppppppppppppppp!!##%%''))--66??AA**''EE((dd99llHHrrVVvv}}ddyyuuss{{oo||ii||ee{{ee{{ee{{ee{{ee{{ee{{ee{{ee{{ee{{ee{{ee{{ee{{ee{{ee{{   ""&&.. 88>>;;--$$II**aa::hhHHnnUUqqwwbbssppqquukkvveevvaauuaauuaauuaauuaauuaauuaauuaauuaauuaauuaauuaauuaauuaauu""-- 88>>!!7700##JJ++^^::ddGGiizzTTllrr``nnjjnnnnee~~oo``pp\\oo\\oo\\oo\\oo\\oo\\oo\\oo\\oo\\oo\\oo\\oo\\oo\\oo\\oo .. 99??""5522""JJ**ZZ99``||EEddttRRffll^^ggeellhh``||ii[[ǍiiWWǚiiWWǚiiWWǚiiWWǚiiWWǚiiWWǚiiWWǚiiWWǚiiWWǚiiWWǚiiWWǚiiWWǚiiWWǚiiWWǚii  ""00 ::??##5522##II))VV77[[vvCC^^nnOO``ff\\aa__jjaaZZyyccVVъccRRїccRRїccRRїccRRїccRRїccRRїccRRїccRRїccRRїccRRїccRRїccRRїccRRїccRRїcc$$22::??##6611%%FF''QQxx55VVppAAXXhhLLZZ``YYZZYYggZZUUww\\PP݈\\MMܕ\\MMܕ\\MMܕ\\MMܕ\\MMܕ\\MMܕ\\MMܕ\\MMܕ\\MMܕ\\MMܕ\\MMܕ\\MMܕ\\MMܕ\\MMܕ\\&&22::>>##77..((CC{{''MMss22PPjj>>RRbbIISSZZVVSSSSddSSOOuuUUJJꆆVVGGꓓUUGGꓓUUGGꓓUUGGꓓUUGGꓓUUGGꓓUUGGꓓUUGGꓓUUGGꓓUUGGꓓUUGGꓓUUGGꓓUUGGꓓUUGGꓓUU''33::>>""::--++>>ww((IInn22KKee<>BBXXHHAAQQSS@@LLaa@@GGooAACCBB@@BB@@BB@@BB@@BB@@BB@@BB@@BB@@BB@@BB@@BB@@BB@@BB@@BB@@BB ))2288<<>>&&88..nn..::ee55<<^^??<>**oo4433cc6677\\??77UUII66NNTT44JJ``33EEmm44AA{{55??55??55??55??55??55??55??55??55??55??55??55??55??55??55<<--??00BB55||DD::yyGG??wwJJDDssPPJJnnVVOOii^^UUhhddZZggjj^^ffppbbddvveebb||gg``ii]]kkZZllVVllRRllLLllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJll<<--??00BB55||DD::yyGG??wwJJDDssPPJJnnVVOOii^^UUhhddZZggjj^^ffppbbddvveebb||gg``ii]]kkZZllVVllRRllLLllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJll<<--??00BB55||DD::yyGG??wwJJDDssPPJJnnVVOOii^^UUhhddZZggjj^^ffppbbddvveebb||gg``ii]]kkZZllVVllRRllLLllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJll<<--??00BB55||DD::yyGG??wwJJDDssPPJJnnVVOOii^^UUhhddZZggjj^^ffppbbddvveebb||gg``ii]]kkZZllVVllRRllLLllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJll<<--??00BB55||DD::yyGG??wwJJDDssPPJJnnVVOOii^^UUhhddZZggjj^^ffppbbddvveebb||gg``ii]]kkZZllVVllRRllLLllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJll<<--??00BB55||DD::yyGG??wwJJDDssPPJJnnVVOOii^^UUhhddZZggjj^^ffppbbddvveebb||gg``ii]]kkZZllVVllRRllLLllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJll<<--??00BB55||DD::yyGG??wwJJDDssPPJJnnVVOOii^^UUhhddZZggjj^^ffppbbddvveebb||gg``ii]]kkZZllVVllRRllLLllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJll<<--??00BB55||DD::yyGG??wwJJDDssPPJJnnVVOOii^^UUhhddZZggjj^^ffppbbddvveebb||gg``ii]]kkZZllVVllRRllLLllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJllJJll;;-->>00@@55}}CC::zzFF??xxHHDDttNNJJooTTOOkk\\UUiiccZZhhii__ggoocceeuuffcc{{iiaakk^^ll[[mmWWnnSSnnMMnnKKmmKKmmKKmmKKmmKKmmKKmmKKmmKKmmKKmmKKmmKKmmKKmmKKmm88--;;11>>66AA;;}}CC@@zzGGEExxIIJJssOOPPnnXXVVmm__\\kkff``jjlleehhrrhhffyykkddnnaapp^^qqYYqqTTrrNNqqPPqqPPqqPPqqPPqqPPqqPPqqPPqqPPqqPPqqPPqqPPqqPPqqPPqq55--8811;;66==<<@@AA}}DDFFzzGGKKvvLLPPqqSSVVpp[[\\nnbbbblliiggkkookkhhvvnnff}}qqccss``tt[[uuVVuuUUuuVVttVVttVVttVVttVVttVVttVVttVVttVVttVVttVVttVVttVVtt22,,55007766::;;==AA@@FF}}CCLLxxIIQQvvOOWWttUU]]rr]]ccppddhhnnllmmllssppii{{ttffvvbbxx]]yyXXzz[[xx\\xx\\xx\\xx\\xx\\xx\\xx\\xx\\xx\\xx\\xx\\xx\\xx\\xx//,,11//445566;;99@@<>''6622""UU22kkFFrr[[xxvvss||nn~~mm}}sszzttyyttyyttyyttyyttyyttyyttyyttyyttyyttyyttyyttyyttyy   ""%%''))11==@@%%//;;$$]]77hhIInn||\\ssqqqqvvjjxxccxxhhvvjjuujjuujjuujjuujjuujjuujjuujjuujjuujjuujjuujjuujjuu    !! ** 55<<@@((**AA&&\\99ddJJiiuu[[mmkkooppeeqq__rr]]qq__pp__pp__pp__pp__pp__pp__pp__pp__pp__pp__pp__pp__pp))55==@@++((CC((YY99__yyIIddooZZggffmmii``ƁkkZZėkkTTIJkkSS»jjSS»jjSS»jjSS»jjSS»jjSS»jjSS»jjSS»jjSS»jjSS»jjSS»jjSS»jjSS»jj      ** 66====,,''DD((UU||99ZZrrHH^^hhXXaa``jjbb[[~~ddUUΔeeOOέddMMθddMMθddMMθddMMθddMMθddMMθddMMθddMMθddMMθddMMθddMMθddMMθddMMθdd -- 77== <<,,((CC''PPuu77UUkkFFXXbbVV[[ZZhh\\UU{{^^PPِ^^JJة^^HHٴ^^HHٴ^^HHٴ^^HHٴ^^HHٴ^^HHٴ^^HHٴ^^HHٴ^^HHٴ^^HHٴ^^HHٴ^^HHٴ^^HHٴ^^  .. 88== ==,,**@@yy((LLnn55OOeeDDRR\\SSTTTTeeUUOOyyWWJJ掎WWEE妦WWBB汱WWBB汱WWBB汱WWBB汱WWBB汱WWBB汱WWBB汱WWBB汱WWBB汱WWBB汱WWBB汱WWBB汱WWBB汱WW""// 88== ??++--<>''5522ll//>>cc99@@[[EEAARRRRAALLaaAAGGrrCCBBDD==DD;;DD;;DD;;DD;;DD;;DD;;DD;;DD;;DD;;DD;;DD;;DD;;DD;;DD%%// 77;;>>%%99--ii00::aa::;;YYEE;;QQRR;;KKaa;;FFpp<>**hh3344^^<<66WWFF66OORR55JJ``44EEoo66AA77<<77;;77;;77;;77;;77;;77;;77;;77;;77;;77;;77;;77;;77;;77$$.. 5599<< {{>>&&ii::--\\<<00UUGG00NNSS//II``..DDnn//@@}}00<<11;;00;;00;;00;;00;;00;;00;;00;;00;;00;;00;;00;;00;;00##-- 4488;;vv==##ii>>))ZZ==,,TTHH,,NNUU++IIaa++DDnn,,@@||,,<<,,;;,,;;,,;;,,;;,,;;,,;;,,;;,,;;,,;;,,;;,,;;,,;;,,;;,,xx99%%zz==((||BB**yyGG--wwJJ11ssOO66ooTT;;kkYY@@gg^^EEccddII__jjMM[[qqQQYYxxTTWW~~WWUUYYRRZZNN\\JJ]]FF]]@@]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]xx99%%zz==((||BB**yyGG--wwJJ11ssOO66ooTT;;kkYY@@gg^^EEccddII__jjMM[[qqQQYYxxTTWW~~WWUUYYRRZZNN\\JJ]]FF]]@@]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]xx99%%zz==((||BB**yyGG--wwJJ11ssOO66ooTT;;kkYY@@gg^^EEccddII__jjMM[[qqQQYYxxTTWW~~WWUUYYRRZZNN\\JJ]]FF]]@@]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]xx99%%zz==((||BB**yyGG--wwJJ11ssOO66ooTT;;kkYY@@gg^^EEccddII__jjMM[[qqQQYYxxTTWW~~WWUUYYRRZZNN\\JJ]]FF]]@@]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]xx99%%zz==((||BB**yyGG--wwJJ11ssOO66ooTT;;kkYY@@gg^^EEccddII__jjMM[[qqQQYYxxTTWW~~WWUUYYRRZZNN\\JJ]]FF]]@@]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]xx99%%zz==((||BB**yyGG--wwJJ11ssOO66ooTT;;kkYY@@gg^^EEccddII__jjMM[[qqQQYYxxTTWW~~WWUUYYRRZZNN\\JJ]]FF]]@@]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]xx99%%zz==((||BB**zzGG--wwJJ11ssOO66ooSS;;kkYY@@gg^^EEccddII__jjMM[[qqQQZZwwTTWW~~WWUUYYRR[[OO\\JJ]]FF]]@@^^::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]::]]{{77&&~~;;((@@**}}CC--zzGG11wwJJ66ssOO<>aa>>aa>>aa>>aa>>aa>>aa>>aa>>aa>>aa>>aa>>aa>>aa44&&99((>>++@@--}}CC11zzFF66wwJJ<>}}CCCCzzGGHHwwJJMMooVVTTll^^ZZjjgg__ggppddddzzhh``kk[[mmVVooOOqqSSppWWnnXXnnXXnnXXnnXXnnXXnnXXnnXXnnXXnnXXnnXXnnXXnnXXnn&&%%++((00**22--55228888;;==??CC~~BBHHzzGGNNttOOTTqqWWZZnnaa``jjkkffggvvjjccnn^^qqWWttTTuuZZrr]]pp]]pp]]pp]]pp]]pp]]pp]]pp]]pp]]pp]]pp]]pp]]pp]]pp""##&&''++**..--1111337766<<99BB==HHAAMM{{IITTwwPPZZssYY``ppddggkkppllff~~pp``ttYYxx\\ww``uuccrrddrrddrrddrrddrrddrrddrrddrrddrrddrrddrrddrrddrr!!##""%%(())++++....4400::33@@66FF::LLAASSHHZZ{{PP``wwYYffqqffmmjjwwrrbbxx__{{ccyyggvvjjttjjssjjssjjssjjssjjssjjssjjssjjssjjssjjssjjssjjss!!## &&&&&&--((22**88-->>//DD22JJ66PP==XXEE__ꂂMMee||WWlluunnrrppwwmmzzmmzzppwwqqttqqttqqttqqttqqttqqttqqttqqttqqttqqttqqttqqttqqtt ##&&""(())&&00%%::&&@@((FF))LL..SS44[[擓;;bb͍LLjjhhqquu||xxzzzzyywwyyttyyttyyttyyttyyttyyttyyttyyttyyttyyttyyttyyttyytt !!$$'' ))&&++++''33$$==FFMMUUح%%^^DDhh``oo}}ttww}}yyvvssssssssssssssssssssssssss  !!$$'')) ,,##..&&11))33**00**!!MM::ffYYmmwwrrvvuuppvvuusswwppwwppwwppwwppwwppwwppwwppwwppwwppwwppwwppwwppwwpp   ##%%((++77@@7700!!SS66dd||QQkkppqqooggssccssjjppnnmmnnmmnnmmnnmmnnmmnnmmnnmmnnmmnnmmnnmmnnmmnnmmnnmm    %% 00 99??$$0099$$XX;;``ssRRffggmmjj__‹mmXXoo^^llddiiddiiddiiddiiddiiddiiddiiddiiddiiddiiddiiddiiddii  ##11 ;;@@'',,==''TTyy<<[[llRR``aakkddZZ̆ffTTɥhhRRggYYeeYYeeYYeeYYeeYYeeYYeeYYeeYYeeYYeeYYeeYYeeYYeeYYee&&33;;??((++??}}((PPqq<>vv++KKii;;PP^^OOTTUUeeVVOO~~YYIIᚚZZCC߻ZZ@@YYAAYYAAYYAAYYAAYYAAYYAAYYAAYYAAYYAAYYAAYYAAYYAAYY++ 55<<??))--<>SS88RR88RR88RR88RR88RR88RR88RR88RR88RR88RR88RR88RR88RR ,, 66<<??((0088ll11CCaa>>EEVVNNGGMMbbIIFFxxKK@@LL::LL55LL55LL55LL55LL55LL55LL55LL55LL55LL55LL55LL55LL55LL,, 55;;>>&&||4433hh33>>^^@@@@TTOOAALLaaBBFFvvDD@@EE::FF55EE55EE55EE55EE55EE55EE55EE55EE55EE55EE55EE55EE55EE ,, 55::>>$$yy88..ee5599[[AA;;RRPP;;KKaa<>@@??;;??66??66??66??66??66??66??66??66??66??66??66??66??66??!!,, 44::==""yy>>++bb7744YYCC55PPPP55JJ``55EErr77??88;;996688668866886688668866886688668866886688668866886688 ++ 3399<<tt>>''__88//WWDD//OOQQ//II``//DDpp11??22::226622662266226622662266226622662266226622662266226622 ** 2277}};;oo==$$``>>++UUEE,,OOSS,,IIaa++DDoo,,??--::--<<++<<++<<++<<++<<++<<++<<++<<++<<++<<++<<++<<++<<++)) 1166xx::kk<< ]]==&&RRDD))KKPP))EE\\((AAll))>>}}**<<((;;&&;;&&;;&&;;&&;;&&;;&&;;&&;;&&;;&&;;&&;;&&;;&&;;&&''// ~~44ss88ff;;YY<<""LL??&&EEJJ&&??VV%%<>MM88NN33NN,,OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OOhh55jj;;!!ll@@##nnFF&&ooMM((ppSS++llXX--hh]]00eebb55aagg99]]mm<>MM88NN33NN,,OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OOhh55jj;;!!ll@@##nnFF&&ooMM((ppSS++llXX--hh]]00eebb55aagg99]]mm<>MM88NN33NN,,OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OOhh55jj;;!!ll@@##nnFF&&ooMM((ppSS++llXX--hh]]00eebb55aagg99]]mm<>MM88NN33NN,,OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OOhh55jj;;!!ll@@##nnFF&&ooMM((ppSS++llXX--hh]]00eebb55aagg99]]mm<>MM88NN33NN,,OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OO((OOkk33mm88!!nn>>##ppCC&&rrJJ))rrPP++nnUU..jjZZ22ff__66bbee::^^kk>>ZZqqBBUUxxEEPPHHLLJJHHMMCCNN??PP::QQ55QQ..RR))RR))RR))RR))RR))RR))RR))RR))RR))RR))RR))RR))RRnn11pp55!!rr::##ss@@&&uuFF))uuLL++qqQQ..mmVV33ii\\88eebb<<``hhAA\\ooDDVVvvHHRR~~KKNNNNJJPPFFRRBBSS==TT77UU00VV11UU11UU11UU11UU11UU11UU11UU11UU11UU11UU11UU11UUqq// tt33""uu88$$ww==&&xxBB))yyHH,,uuMM//ppRR44llXX99hh^^>>ccddBB^^llGGXXssJJSS{{NNPPQQMMSSIIUUDDWW??XX99YY44YY88YY88YY88YY88YY88YY88YY88YY88YY88YY88YY88YY88YYtt,, ww11""yy55$${{::''}}??))||DD++yyHH//ttMM44ppSS::kkZZ??ff``DD``hhII[[ppMMWWyyQQTTTTPPWWLLYYGGZZAA\\;;]];;]]??\\??\\??\\??\\??\\??\\??\\??\\??\\??\\??\\??\\ww)) zz..""||33$$~~77''<<))@@,,||DD//yyHH44ttNN::ooTT@@ii\\EEddccJJ]]llOOZZvvSSWWWWSSZZOO\\II^^DD``==aaBB``FF__FF__FF__FF__FF__FF__FF__FF__FF__FF__FF__FF__zz&& }}++""//$$44''99**==,,@@//||DD55yyHH::ttNN@@nnVVFFhh^^KKaahhQQ]]rrUUZZ||YYVV]]QQ``LLbbEEddDDddIIccLLaaLLaaLLaaLLaaLLaaLLaaLLaaLLaaLLaaLLaaLLaaLLaa}}""''""++$$00''55))99,,<<00@@55}}DD::yyHH@@ttNNFFmmWWLLeeccRRaammWW^^xx\\YY``TTccNNffGGiiKKggPPeeSSddSSddSSddSSddSSddSSddSSddSSddSSddSSddSSddSSdd""!!''$$,,&&11))55,,88//;;55??::}}CC@@yyHHEEttNNKKjj[[RRffggXXaass^^\\bbWWggPPjjLLllSSjjWWggYYffYYffYYffYYffYYffYYffYYffYYffYYffYYffYYffYYff ""##&&&&++((00++22..664499::==??AAEEzzGGKKssPPQQll^^YYffll__``}}eeYYjjQQppTTooZZll^^ii``gg``gg``gg``gg``gg``gg``gg``gg``gg``gg``gg``gg ""!!%%''****----0022228866>>::DD??JJzzGGPPttQQWWmmaa__eeuuff__ll\\pp^^ppccmmffjjgghhgghhgghhgghhgghhgghhgghhgghhgghhgghhgghhgghh  ##%%%%&&,,((//++55..;;11AA44GG99NNBBUU{{QQ]]ttmmeeoojjkknniiqqllnnnnkknniinniinniinniinniinniinniinniinniinniinniinnii  ""%% ''&&''--$$77&&==''DD((JJ++PPюHH[[eeccii||llyyooxxnnxxkkxxhhxxhhxxhhxxhhxxhhxxhhxxhhxxhhxxhhxxhhxxhhxxhh   ""%%((!!**%%,,**++..++33ݰNN>>YY]]aa||ggkkzzmmyyllzziizzggzzggzzggzzggzzggzzggzzggzzggzzggzzggzzggzzgg   !!$$''))--99''@@44WWUU__}}vvddsshhkkkkmmiippffqqddqqddqqddqqddqqddqqddqqddqqddqqddqqddqqddqqdd      ++ 77==5511))TTyyLL\\lloobbbbff[[hh``ffeeccggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa  ,, 88>>##0099||**PPkkGGXX]]ii^^TTҏbbMMͻeeTTbbZZ__]]^^]]^^]]^^]]^^]]^^]]^^]]^^]]^^]]^^]]^^]]^^]]^^ !!00 ::??&&--==rr..LLccGGRRWWffWWOO߈[[HHڰ]]FF]]NNZZRRYYRRYYRRYYRRYYRRYYRRYYRRYYRRYYRRYYRRYYRRYYRRYY$$22::??''--==ll33HH\\HHLLPPccPPIITTCC騨VV==VVBBUUFFTTFFTTFFTTFFTTFFTTFFTTFFTTFFTTFFTTFFTTFFTTFFTT''33;;>>''zz..;;ff77CCYYJJGGNNbbJJEELL==NN77OO44OO::NN::NN::NN::NN::NN::NN::NN::NN::NN::NN::NN::NN((33::>>&&tt1177bb::>>VVKKAALLaaCCEE{{FF>>HH77HH22HH33GG33GG33GG33GG33GG33GG33GG33GG33GG33GG33GG33GG )) 33::>>%%pp5522__<<99TTMM;;KKaa==DDxx??>>AA88AA33AA//AA//AA//AA//AA//AA//AA//AA//AA//AA//AA//AA//AA )) 3399==""mm::--\\>>44RRNN66JJ``77DDuu99>>::88;;33;;00::00::00::00::00::00::00::00::00::00::00::00:: )) 2288}}<< ll>>))YY??..QQOO00II``00CCss22>>4499444444660066006600660066006600660066006600660066006600 ((1177ww;;gg==&&XXAA,,PPQQ,,II``,,CCrr--==..99..;;,,<<))<<))<<))<<))<<))<<))<<))<<))<<))<<))<<))<<)) ''00 ~~66qq::bb==""SS@@))LLNN))FF^^))BBpp**>>++<<))<<&&;;$$;;$$;;$$;;$$;;$$;;$$;;$$;;$$;;$$;;$$;;$$;;$$ %%.. xx44ll88^^;;NN==%%FFII&&@@WW&&==hh''<<~~%%;;##::!!999999999999999999999999 $$}},, rr22gg77ZZ::KK<>117744444444444444444444444444444444444444444444YY33ZZ99\\??^^EE__KK!!``QQ##``WW&&``]]((``dd))__jj++[[oo--WWuu//SS||22NN44JJ66EE88@@::;;;;77==11==,,>>117744444444444444444444444444444444444444444444YY33ZZ99\\??^^EE__KK!!``QQ##``WW&&``]]((``dd))__jj++[[oo--WWuu//SS||22NN44JJ66EE88@@::;;;;77==11==,,>>117744444444444444444444444444444444444444444444ZZ22\\88^^==__CC ``II""aaPP$$bbVV&&bb\\((bbcc**``ii,,\\nn..XXtt00SS{{33OO66JJ88EE::@@<<<<==66>>11??++@@//::22772277227722772277227722772277227722772277]]//__44aa::cc@@ ddFF""eeMM$$eeSS''ffZZ))eeaa++aaff--]]ll//YYrr33TTyy66PP99KK;;FF>>AA@@<>TTzzBBMMEEHHHHBBKK<>QQ88SS11UU22UU77SS99SS99SS99SS99SS99SS99SS99SS99SS99SS99SS99SSmm""oo&&rr++tt//!!vv44##xx99%%yy??((zzFF++vvKK..qqRR33kkYY88eeaa==__jjBBXXttGGQQKKKKOOFFRRAAUU::WW33ZZ::XX??VV@@UU@@UU@@UU@@UU@@UU@@UU@@UU@@UU@@UU@@UU@@UUpprr""uu''xx,,!!zz11##||66%%}};;((AA++zzFF--vvKK33ppSS99ii[[>>cceeDD[[ooIISS{{MMNNRRIIUUCCYY<<\\;;]]AAZZFFXXGGXXGGXXGGXXGGXXGGXXGGXXGGXXGGXXGGXXGGXXGGXXvvuuxx##{{(( }}--##22%%77((==++AA--{{EE22vvKK88ooTT??gg^^EE__iiJJWWwwOORRTTLLYYEE]]>>aaCC__II]]MMZZNNZZNNZZNNZZNNZZNNZZNNZZNNZZNNZZNNZZNNZZNNZZ~~~~||~~## ((""--%%22((88++<<--@@22||DD88vvKK>>nnUUEEeebbKK[[qqQQUUWWOO\\GGaaDDddKKaaPP__TT\\UU[[UU[[UU[[UU[[UU[[UU[[UU[[UU[[UU[[UU[[UU[[ """"''$$,,''22**55--9911>>77}}CC==wwIICCmmWWKKaahhRRZZ||YYQQ``KKffMMffTTccXX``[[^^\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\  ""!!%%&&++))//,,22006666;;<>$$++??ff@@JJWWffPPMMܒUUFFXXIIWWPPUUTTSSUURRUURRUURRUURRUURRUURRUURRUURRUURRUURRUURR  // 99>>&&qq++??^^BBFFNNbbKKCCOO<>''jj00;;ZZEEAAMMaaEECCHH::JJ33LL88JJ@@IICCHHCCHHCCHHCCHHCCHHCCHHCCHHCCHHCCHHCCHHCCHH%%22::>>&&ee4477WWHH;;KKaa>>CCAA;;CC44EE11DD99CC<>$$aa7722TTII55JJ``88BB{{;;;;==55>>00>>33==66<<66<<66<<66<<66<<66<<66<<66<<66<<66<<66<<''2299vv==""]]::..RRKK00II``22BBxx44<<6666773355661111441144114411441144114411441144114411441144&&1188oo<< \\>>++QQMM,,II``--BBuu..<>((>>((>>((>>((>>((>>((>>((>>((>>((>>((>>((&&// yy66ii;;WW==''NNLL))GG__**BBtt++<<++==))<<'';;$$;;"";;"";;"";;"";;"";;"";;"";;"";;"";;"";;"" $$~~.. rr55dd::SS<<""HHGG&&AAXX''==ll((<<&&;;$$::!!888888888888888888888888##xx,, ll33^^88OO;;BBBB##<>@@99PP99ee77{{6655333333333333333333333333{{sskk''``.. UU44GG88;;>>77MM66aa55uu332200//////////////////////yyttmmdd$$[[++ PP11CC5588<<44JJ33\\22oo00//--,, ,, ,, ,, ,, ,, ,, ,, ,, ,, ,, NN55JJ88LL>>MMCCNNIIOONNOOTTOOZZ OO``""OOgg##NNmm%%MMtt&&LL{{''JJ))HH**EE++@@++;;,,::++<<))<<&&;;##<< <<<<<<<<<<<<<<<<<<<<NN44KK88LL==MMCCNNHHOONNPPTTPPZZ PP``""PPff##OOmm%%NNtt&&LL{{((JJ))HH**EE++@@,,;;,,99,,<<**<<''<<$$<< == == == == == == == == == == QQ11NN55OO::QQ@@RRFFSSLLSSRRTTXX!!TT__##SSee%%RRll&&QQss((PP{{))NN**JJ,,EE--@@..;;..550088--==**==''AA##BB##BB##BB##BB##BB##BB##BB##BB##BB##BB##TT..QQ11SS77TT==UUCCVVIIWWPP XXVV""XX]]$$WWdd&&VVkk''UUrr))TTzz++OO,,JJ--EE//@@11;;225544333388..>>**CC))CC))CC))CC))CC))CC))CC))CC))CC))CC))CC))VV++TT..VV44XX::YY@@ZZFF[[MM!![[TT##\\ZZ%%[[bb''ZZii))YYqq**UUxx,,PP..KK00FF22@@44::665588//::3344<<--::11::11::11::11::11::11::11::11::11::11::11ZZ((XX**YY00[[66]]<<^^CC__JJ!!__QQ##__XX&&____((^^gg**\\nn,,VVvv--QQ~~00LL33FF66@@88::::44<<..>>..::5577..==..==..==..==..==..==..==..==..==..==..==]]&&[['']],,^^22aa88bb??ccFF!!ccMM$$ccTT&&cc\\((ccee++^^ll--XXss//SS||33MM66GG99@@<<::>>44AA,,CC**AA((DD00BB00BB00BB00BB00BB00BB00BB00BB00BB00BB00BB``##^^%%aa))bb..dd33ff::ggAA""hhII$$hhQQ''hhYY))eeaa++``hh..ZZpp22TTyy66NN99GG==AA@@::CC33EE++HH$$II,,HH55FF66FF66FF66FF66FF66FF66FF66FF66FF66FF66FFdd bb""dd&&ff++hh00jj55kk<<""llDD$$llLL''llTT**ii\\,,ccdd//]]mm44VVvv88OO<>[[ooEEPPKKFFRR>>YY;;\\DDYYJJVVOOTTVVQQVVQQVVQQVVQQVVQQVVQQVVQQVVQQVVQQVVQQVVQQ   ~~$$!!))##//&&55));;,,@@//yyHH66ooTT==bbeeEESS||MMIIUUGGZZEE^^MM[[RRXXXXUU^^RR__RR__RR__RR__RR__RR__RR__RR__RR__RR__RR !!""''%%,,((33++77..==44{{EE;;nnVVCC__ssLLZZTTWWYYUU\\XX\\\\YYbbVVhhSShhRRhhRRhhRRhhRRhhRRhhRRhhRRhhRRhhRRhhRR    !!$$%%(()),,,,11118888zzQQBBrrkkJJllQQhhWWeeZZee\\hhYYnnVV~~qqSS}ICC_PROFILE~~qqRR~~qqRR~~qqRR~~qqRR~~qqRR~~qqRR~~qqRR~~qqRR~~qqRR~~qqRR    ##%%!!((''2266ЍII@@ccHHOO{{TTxxXX~~vv[[zzxxXXwwzzUUuu||RRtt||RRtt||RRtt||RRtt||RRtt||RRtt||RRtt||RRtt||RRtt||RRtt||RR     ++ѩ**44@@==[[FF{{LL~~RRttVVmmXXllVVllSSkkPPjjPPjjPPjjPPjjPPjjPPjjPPjjPPjjPPjjPPjjPP  **11**88;;TTCCzzttJJllOOccSS[[UU__SS``PPaaMMaaMMaaMMaaMMaaMMaaMMaaMMaaMMaaMMaaMMaaMM(( 33 0099yyLL@@iinnFF[[KKQQOOKKQQQQOOUULLYYJJYYJJYYJJYYJJYYJJYYJJYYJJYYJJYYJJYYJJYYJJ,, 7744..iiEE==ZZggCCMMܒHHCCKK==MMGGJJMMHHRRFFRRFFRRFFRRFFRRFFRRFFRRFFRRFFRRFFRRFFRRFF // 99>>))\\@@::LLaa@@@@DD66GG44HH>>EEEECCJJAAKKAAKKAAKKAAKKAAKKAAKKAAKKAAKKAAKKAAKKAA""00 ::uu>>))XXCC55KK``99@@==88@@00BB66@@>>>>DD<>''UUFF//JJ``33@@66999922:://::7788==77>>77>>77>>77>>77>>77>>77>>77>>77>>77>>77$$11zz99ee==%%SSII,,II``--@@{{0099226611::--330077118811881188118811881188118811881188118811$$00 rr88__<<""OOHH))HH``**AAyy,,::,,==**<<''<<%%77**77**77**77**77**77**77**77**77**77**77**$$zz// kk66YY;;IIDD&&CCZZ''>>rr((<<'';;$$::""::66 66!!66!!66!!66!!66!!66!!66!!66!!66!!66!!}}##rr-- ee55TT::CC@@$$==SS$$;;mm##::!!9988666666666666666666666666}}uu!!kk++ __33OO88@@??::PP99ii887755333333333333333333333333{{vvnndd)) YY11KK66====77NN66dd55}}442200......................ttnngg^^&&SS.. FF4499;;44KK33``22vv11//--++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ||mmgg``WW##MM++ AA11558811GG00[[//oo--++ )) && && && && && && && && && && && vvhh`` YYQQGG''<<.. 1155--CC,,UU ++hh ))|| '' $$""""""""""""""""""""""GG44??66>>::??@@@@EEAAKKAAPPBBVVAA\\AAbb@@ii??oo >>vv!!<<~~""::##99##99""88!!887766664466666666666666666666JJ22BB33AA88CC==DDCCDDIIEENNEETTEE[[EEaaDDhh CCoo!!BBvv""@@~~##>>$$;;%%::%%99$$99""99 887788;;;;;;;;;;;;;;;;;;;;LL//EE00EE55FF::GG@@HHFFIILLIISSIIYYII``HHgg!!GGnn""FFuu##DD}}%%AA&&??'';;((;;''::%%::##:: 99==>>>>>>>>>>>>>>>>>>>>OO++HH,,HH11JJ77KK==LLCCLLJJMMPPMMWWMM^^ LLee""KKmm##IIuu%%GG}}&&EE((BB))??**<<++<<));;&&;;##;; @@ @@""@@""@@""@@""@@""@@""@@""@@""@@""@@""RR((KK((KK..MM44NN::OO@@PPGGQQNNQQUUQQ\\!!PPcc##OOkk$$MMtt&&KK||((II))FF++@@,,::--99,,==**==''??$$BB&&BB((BB((BB((BB((BB((BB((BB((BB((BB((BB((UU%%NN$$OO))QQ//RR66SS==TTCCUUJJUURR UUYY""TTaa$$SSii&&QQrr''OO||))LL++FF,,@@..9900441188-->>**CC))@@,,<<..<<..<<..<<..<<..<<..<<..<<..<<..<<..YY##RR""RR%%SS,,VV11WW88XX??YYGGYYNN YYVV""XX^^%%WWgg''UUqq))SS{{**MM,,GG..@@11994422663333::..;;0055665577557755775577557755775577557755775577\\ UUVV""XX''YY--[[33\\::]]BB]]JJ!!]]RR##]][[%%[[dd((ZZnn**UUxx,,NN..HH11@@44888811;;..::6666..==55<<;;::;;::;;::;;::;;::;;::;;::;;::;;::;;::__YYZZ\\$$]]))__..``55aa==bbEE!!bbNN##aaWW&&``aa((^^kk++WWuu--PP00HH44@@8888<<00@@**AA((CC22BB;;??@@==@@==@@==@@==@@==@@==@@==@@==@@==@@==bb\\]]__ aa%%cc**ee00ee77gg??!!ffHH$$ffRR&&ee\\))aagg,,ZZqq..RR}}33II77@@<<88@@..EE%%II--GG88DDAABBFF@@FF@@FF@@FF@@FF@@FF@@FF@@FF@@FF@@FF@@iicc``ccee!!gg&&ii,,jj11kk88!!llAA##kkKK&&jjVV))eeaa,,]]ll00TTyy55KK::AA@@77EE++KK))MM55JJ@@GGHHDDMMBBMMBBMMBBMMBBMMBBMMBBMMBBMMBBMMBBMMBBqqkk jjhhiikk""mm''oo--pp33 qq99##qqCC&&ppNN))jjZZ,,bbff11XXtt77MM==AACC55JJ**QQ11OO>>LLHHIIPPFFTTDDTTDDTTDDTTDDTTDDTTDDTTDDTTDDTTDDTTDDxx ssrr rrqqooqq""ss''uu-- vv44##ww;;&&uuEE))rrQQ,,hh]]11]]mm88OO??BBGG44PP22UU;;QQHHNNQQKKXXHH\\EE\\EE\\EE\\EE\\EE\\EE\\EE\\EE\\EE\\EE~~yy zz{{ ||{{xxxx zz&& ||,,""}}33%%}};;(({{EE++qqRR00ddcc88TTzzAAHHIIBBOOAASSGGRRSSOO[[LLaaIIeeFFeeFFeeFFeeFFeeFFeeFFeeFFeeFFeeFFeeFF ~~  $$!!**$$11''::**~~BB..jj[[66aatt??ZZGGTTMMRRQQUUSS``PPggMMllIIooGGooGGooGGooGGooGGooGGooGGooGGooGGooGG   !!$$&&++))>>--zzTT55ssll==mmEEggKKddOOffRRooPP~~qqMM}}qqII||ssFF||ssFF||ssFF||ssFF||ssFF||ssFF||ssFF||ssFF||ssFF||ssFF    %%씔66,,̌LL33ee;;BB{{HHwwLLzzvvPPrr~~OOqqLLqqHHppEEppEEppEEppEEppEEppEEppEEppEEppEEppEE  ''ͦ//++DD00^^99||??EEssIIiiLLddLLffIIggFFhhCChhCChhCChhCChhCChhCChhCChhCChhCChhCC$$,,$$==..WW66||uu==nnBBccFFZZIIYYHH\\EE__CC``@@``@@``@@``@@``@@``@@``@@``@@``@@``@@  --55--{{PP33lloo99__>>UUBBKKEENNDDSSBBWW??YY==YY==YY==YY==YY==YY==YY==YY==YY==YY==,,44((llII00^^ii66QQԐ;;GG????AADD@@KK==PP;;RR99RR99RR99RR99RR99RR99RR99RR99RR99RR99 00 ||::^^BB..PPcc33EE77;;;;33==<<;;CC99II66LL55LL55LL55LL55LL55LL55LL55LL55LL55LL55""11rr;;WWBB++II``..>>22665533444455<<33BB11EE00EE00EE00EE00EE00EE00EE00EE00EE00EE00$$~~11ii::RRBB))IIaa++??--99--<<++<<**55..<<--@@--@@--@@--@@--@@--@@--@@--@@--@@--@@--$$tt11bb99KK??&&DD[[((>>zz))<<((;;%%;;##66%%77))99**99**99**99**99**99**99**99**99**99**yy##ll00 [[88FF>>##>>TT%%;;tt$$::""99 888833 44##44##44##44##44##44##44##44##44##44##zzqq""ee.. UU66CC==::QQ 99nn887755551100000000000000000000xxrrii ^^,, OO44??;;88NN77ii5544221100--------------------oojjaaWW)) JJ22;;9955KK44dd22~~11//--,, ** ** ** ** ** ** ** ** ** ** yyiibbZZPP&&DD// 777722HH00__//ww--,, )) '' && && && && && && && && && && sscc[[ SSJJ##??++ 3344..DD--YY ++oo )) '' %% ""          ||mm]]SSLLDD99''..00 **?? ((SS ''gg %%||## vvhhXXLLEE==33##))++ %%::##LL""__ ssCC22::33335544::55@@66FF77KK77QQ77WW66]]66dd55kk55rr55zz5544444433221100..00 11 11 11 11 11 11 11 11 11 EE00==116622888899==::CC::II;;OO;;VV::\\::cc88jj77qq66yy66666655554433222255666666666666666666HH--@@..:://;;55==;;==AA>>GG>>MM>>TT>>ZZ==aa<>BBDDBBKKBBRRBBYYAA``@@gg??pp ==xx!!;;""99##99""88!!88887777;;<<==================MM&&GG&&AA((BB..DD44EE;;EEAAFFHHFFOOFFVVEE^^DDffCCnn!!AAxx"">>$$;;%%::%%::$$99""99 99;;>>???? ?? ?? ?? ?? ?? ?? ?? ?? QQ##JJ""DD##FF**GG00II77II>>JJEEJJLLJJSSII\\HHdd GGmm""EEww$$BB%%??''<<((;;'';;%%;;##;;!!@@@@""AA%%@@&&@@&&@@&&@@&&@@&&@@&&@@&&@@&&@@&&TT MMGGII%%KK++LL22MM99NNAANNHHNNPPMMYYLLbb!!KKkk##IIuu%%FF''CC((??**;;++<<))<<''>>$$BB%%BB((AA++??,,??,,??,,??,,??,,??,,??,,??,,??,,WWQQKKMM!!OO&&PP--QQ44RR<<RRDDRRLLRRUU QQ^^""OOii$$MMss&&JJ((GG**@@,,88..99--==**CC((@@,,::00==00??//??//??//??//??//??//??//??//??//ZZTTOOQQSS""TT''VV..WW66WW??WWGGVVQQ UU[[""SSee%%QQqq''NN~~))II++@@..7711332288..;;004477;;55BB33EE22EE22EE22EE22EE22EE22EE22EE22EE22^^XXRRTTWWYY$$ZZ))[[11\\88\\AA\\KK ZZVV##XXaa%%VVnn((RR||**JJ--@@116666//996666..==88;;AA88HH55KK44KK44KK44KK44KK44KK44KK44KK44KK44ffaa [[ YY[[]]^^%%``**aa11aa::aaDD ``OO##]]\\&&[[ii))UUxx,,KK//@@5555;;**AA((CC55@@@@==HH::OO77RR66RR66RR66RR66RR66RR66RR66RR66RR66nn hh cccc aaaacc dd%%ff++gg22gg<< eeGG##ccTT&&``cc))YYss,,MM11@@8833@@%%II00FF>>CCHH??PP<>^^::``99``99``99``99``99``99``99``99``99zz tt oorr ttuu ttqqppqq$$ss++ss33""rr>>%%ooNN))eeaa--SS{{44LL<>gg;;ii::ii::ii::ii::ii::ii::ii::ii::ii::~~yyssxx|| ~~  {{yy""zz))!!{{11$$ww@@''kk]],,cctt22\\::WW@@SSEEWWIIbbFFhhBBmm??~~qq;;~~qq::~~qq::~~qq::~~qq::~~qq::~~qq::~~qq::~~qq::~~qq::xxrrzz  """"}}<<&&zzVV++ttmm00nn77ii>>eeBBeeFF~~qqFF~~ppBB||rr??zztt;;yyuu99yyuu99yyuu99yyuu99yyuu99yyuu99yyuu99yyuu99yyuu99  $$ތ44&&ȊNN**gg..55{{;;xx@@||uuCCppEEppAAoo>>oo::oo88oo88oo88oo88oo88oo88oo88oo88oo88髫!!œ++%%EE))``--||2288vv<>ff;;gg77gg66gg66gg66gg66gg66gg66gg66gg66gg66  ''==((YY,,~~vv//qq55ff99^^<>7766LL44jj331100//++,,,,,,,,,,,,,,,,,,,,wwdd]]TTHH++ 995522HH11dd//..,, ** )) && ''''''''''''''''''oo^^UUMMBB((5522//DD--^^,,xx ** (( %% ##!! yyiiXXNN FF<<$$00.. ++@@ ))WW ''oo %% ##!!ssccRRFF??66 ++** &&;; $$PP""ff }}||mm]]MM??88//%%%% 55II]]rrvvhhXXII9911 )) //AATThh||  >>116622--33 **66 ++;;,,AA--GG--MM..SS//ZZ//aa//hh//pp//xx////..----++** (( && ''** ++ ++ ++ ++ ++ ++ ++ ++ @@..99//1100--33 ..99//>>//DD00KK00QQ11XX11__11ff11nn11ww11110000//..--++ ** -- 00 00 00 00 00 00 00 00 00 DD++<<,,44--0000226622<<33BB44HH44OO33VV33]]33dd33mm33vv333322221100//..00 33444444444444444444GG''??((88))44,,5522669977??77FF77LL77TT77[[66cc55kk55tt55444444332222115577888888888888888888II##CC$$;;%%77((99//::55;;<<;;CC;;JJ;;QQ;;YY99aa88jj66ss66~~6666665555446699::;;;;;;;;;;;;;;;;;;MM FF >> ;;$$<<**>>11??88??????FF??NN??VV>>__<>@@&&BB,,CC44CC;;CCCCCCKKCCSSBB\\@@ff>>pp<<||!!99##99""88!!8888::>>????"">>$$>>$$>>$$>>$$>>$$>>$$>>$$>>$$>>$$SSMMEEBBDD FF''GG..GG66HH>>HHGGGGOOFFYYEEccBBnn @@{{""<<$$::%%::$$::"":: @@@@""@@%%@@((@@))@@))@@))@@))@@))@@))@@))@@))@@))VVPPIIFFHHJJ!!KK((LL00LL99LLAALLKKKKUUII``GGll!!DDyy$$@@&&<<((;;((;;&&<<$$BB%%BB))??,,BB,,HH**HH**HH**HH**HH**HH**HH**HH**HH**\\VVOO JJLLNNOO##PP**QQ22QQ;;PPEEOOPPNN[[ KKhh""HHvv%%DD''??**;;++==**CC((@@,,8811AA..II--OO++OO++OO++OO++OO++OO++OO++OO++OO++dd ^^ WWSS QQRRTTUU$$VV++VV44VV>>UUIISSVV PPdd##LLss&&HH))@@,,55//88..;;005577@@33II00PP..UU,,VV,,VV,,VV,,VV,,VV,,VV,,VV,,VV,,kkee^^ [[[[ YYXXZZ[[$$\\++\\55[[AAYYNN VV]]##QQnn&&LL**@@..2266226600==>>99HH55QQ22WW//\\--]]--]]--]]--]]--]]--]]--]]--]]--qq kk dd aa cccc bb__``bb%%bb,,bb66``DD \\TT##WWgg''PP++@@11998844==;;>>HH::RR77YY33__00dd--dd--dd--dd--dd--dd--dd--dd--dd--vv ppiiggjj ll mmll iigghh$$ii,,hh66ddGG""^^]]&&UU||++OO//II55DD;;HH??TT;;]]88cc44hh11ll..mm..mm..mm..mm..mm..mm..mm..mm..yyssiiggoossvv xxxx wwrrpp!!pp))gg@@!!eeYY&&cctt**^^--YY33UU88UU<>##??##??##??##??##??##??##??##??##ttkk]]** HH7799OO77{{665544112233""66!!66!!66!!66!!66!!66!!66!!66!!66!!iiaaTT((BB5566LL55rr332211,,..//000000000000000000uu``YYMM&&==3333II11kk00..,,,, ))++,,,,,,,,,,,,,,,,,,llXXPPFF##770000EE..dd,, ** (( '' $$ %% ''((((((((((((((((wwddQQII?? 22-- ++AA **\\ ((yy && $$!! !! "" "" "" "" "" "" "" "" oo^^KKAA 88,,(( ''<< %%UU##oo!!yyiiXXEE99 11''$$""66 MMee~~ssccRRAA22**!!00EE[[rr         ||mm]]MM<<++## ))==RRgg }} vvhhXXII99((""55 HH [[oo:://2200))11 ##33##88$$== %%CC &&JJ ''PP ''WW ((^^ ((ee ((ll ((uu ((}} '' '' && %% ##!!!!################<<,,55----.. %%00 %%55 &&;; ''AA ((GG ))NN **UU **\\++cc++kk++tt**}}** )) )) '' && %% ##!!$$''))))))))))))))))??))88**00++ '',, ''11 ((77 **>> ++DD++KK,,RR,,ZZ--bb--jj--ss--}},,,,++** )) (( && ''** ,, .. .. .. .. .. .. .. .. CC%%;;&&33'' ++(( **.. ++44 ,,::,,AA--HH..OO..WW//``//hh//rr//||//....--,,++ )) -- 00 112222222222222222EE!!??""77## ..$$ --** //00 //7700>>00EE00LL00TT11]]11ff11pp11{{110000////..// 2244556666666666}ICC_PROFILE666666IIBB:: 22 11%% 33,, 443344::44AA44II44QQ33ZZ33dd33nn33zz332222221100557788889999999999999999LLEE>> 66 55 77'' 88..886699==99FF88NN77WW55aa44ll44xx44444444334499::;;;;;;;;;;;;;;;;;;;;OOHHAA 99 99 ;;!! <<))==11==99==AA<>[[<>?? ??"">>%%??%%AA$$AA$$AA$$AA$$AA$$AA$$AA$$AA$$ZZ SS LL DD AA CC EEFF##FF,,FF66FF??EEJJCCVVAAcc==rr::""99""99!!:: ??@@##@@&&??))DD((GG&&II%%II%%II%%II%%II%%II%%II%%II%%aa [[SSLL JJGG IIJJKK%%LL..KK88JJCCHHPPEE^^BBnn >>##::%%::$$<<$$BB%%AA**@@,,HH**LL))OO''QQ&&QQ&&QQ&&QQ&&QQ&&QQ&&QQ&&QQ&&ggaa ZZ SS RR QQOO OOPPQQ%%QQ//PP;;NNHHKKWWGGii!!BB~~$$<<((<<((88**??-->>//II--QQ++UU))XX((YY''YY''YY''YY''YY''YY''YY''YY''mm gg``XXYYZZ ZZYY UUWWXX%%WW//UU==QQNNMMbb!!FFzz%%@@))==,,8800;;55II00RR--ZZ,,__**``((aa''aa''aa''aa''aa''aa''aa''aa''qqkkccYY]]aacc ddcc __^^^^%%]]//ZZ@@PP\\!!OOuu$$NN((LL++GG..GG22UU11^^..dd,,hh**ii))||jj''||jj''||jj''||jj''||jj''||jj''||jj''||jj''ttjjddbb__ddjjnnpp oomm ffff""^^<<]]TT ]]nn$$\\''[[**WW--TT//cc11jj..oo,,}}pp**{{nn))yyll''yyll''yyll''yyll''yyll''yyll''yyll''yyll''ttssrrqqppnnllrryy}} llll44kkLLkkff##jj&&ii))hh++ee--~~qq//}}pp..{{ss,,xxuu**uutt((rrss''rrss''rrss''rrss''rrss''rrss''rrss''rrss''zz++zzDDyy^^""yy{{%%xx((ww**vv,,uu{{--nn--mm++ll**jj((hh}}&&hh}}&&hh}}&&hh}}&&hh}}&&hh}}&&hh}}&&hh}}&&噙ʔ "";;VV!!ss$$&&ww((pp**gg,,bb++cc**bb((aa''``%%``%%``%%``%%``%%``%%``%%``%%ڥʨ22MMwwkk""oo%%gg''aa))YY**WW**XX((YY''YY%%XX$$XX$$XX$$XX$$XX$$XX$$XX$$XX$$宮԰ų  zz))ppEEggcc!!__##XX%%RR''KK((KK((NN&&OO%%PP$$PP##PP##PP##PP##PP##PP##PP##PP##䶶ӹĻll""``<<XX[[ PP}}""JJ$$DD%%>>&&@@&&DD$$FF##HH""HH!!HH!!HH!!HH!!HH!!HH!!HH!!HH!!徾wwee!!QQ22IIRRBBuu <<Ο""77##44!!55##::""==!!?? @@ @@ @@ @@ @@ @@ @@ @@ {{ii[[FF..::II66pp44꟟33//002244 668888888888888888rr]]SS@@..33GG11qq//....,,..//000000000000000000}}iiTTJJ;;.. 00FF..ll--++ ** && ((**++,,,,,,,,,,,,,,,,uu``KKCC55** ,,BB **dd (( && $$##"" %% ''((((((((((((((((llXXBB;;//''((== &&[[ $${{""!! "" "" "" "" "" "" "" "" wwddQQ<<44))""##77!!SSppoo^^KK77,,##11JJdd yyiiXXEE22%% ++BBZZss         ssccRRAA..$$99 OO ff~~||mm]]MM<<++  00EEZZppvvhhXXII99((((==RRii66--.... ''00 2244::@@FFLLSSZZaaiiqqzz99**11++ )),, ""..1177== CC!!JJ!!QQ""XX""``""hh ""qq ""zz!!!!  !!!!!!!!!!!!!!<<''44(( ,,)) $$++ -- 44!!::""AA##HH $$OO %%VV %%^^ %%gg %%pp %%zz $$ $$ ##"" !!$$&&&&&&&&&&&&&&&&??##88$$ //%% '''' !!**""00$$77 %%== &&EE ''LL ''TT ((\\ ((ee ((oo ((yy '' '' && %% $$""!!$$'')) ++ ++ ++ ++ ++ ++ ++ ++ AA;; 33!! **## ##%%%%,, &&33 '':: ((AA ))II **QQ **ZZ **cc**mm**xx** )) )) (( '' && &&** -- .. // 00 00 00 00 00 00 00 EE>> 66 .. && '''' ((.. **55 **== ++EE,,NN,,WW,,aa--kk,,ww,,,,++++ ** )) -- 00 11333333333333333333HHAA :: 22 ** ++"" ,,)) --11 --99--AA..JJ..SS//^^//ii//vv......------ 224455666666666666666666KKEE == 55 -- // 11## 22++ 224422<<22EE11OO11ZZ11ff11tt110000000055668888998888888888888888PP II AA 99 22 44 55 66%% 77..777766@@55JJ44VV22bb22qq222222223399::;;;;::::::::::::::::::WW PP IIAA99 88 :: ;; ;;'';;00;;::::EE88QQ66^^44mm44444455::<<==== <<"">>""AA BB BB BB BB BB BB BB ^^WW PP HH AA @@>> @@ @@AA((@@33??>>==KK;;YY77ii66}}666677>>>> >>$$??%%DD$$GG""II!!JJ JJ JJ JJ JJ JJ JJ dd ]] VVNNGGHH HHEE FFGGFF))EE55CCCC@@RR<>IIWWHHooHH""GG%%FF((FF**UU++[[))^^''``%%{{aa$$vvbb""ttbb!!ttbb!!ttbb!!ttbb!!ttbb!!ttbb!!ttbb!!kkffddbb__]]YY``ddff eeaa VV##VV88VVOOVVggUU!!UU$$TT&&TT((bb**hh)){{jj''wwjj%%uuhh$$rree""qqdd!!qqdd!!qqdd!!qqdd!!qqdd!!qqdd!!qqdd!!ttssrrqqppnnlljjggoossrr dddd00ddGGdd``cc{{ cc##bb%%bb''kk)){{nn))vvnn''rrnn%%oomm##llll""jjkk!!jjkk!!jjkk!!jjkk!!jjkk!!jjkk!!jjkk!!{{~~xx rr''rr>>rrWWrrssqq""qq$${{qq&&tttt''jj((hh}}&&ff{{%%ddxx##bbvv!!aauu!!aauu!!aauu!!aauu!!aauu!!aauu!!aauu!!ጌҍ66OOkkyy rr""kk$$dd&&]]&&\\%%\\##[[""YY}} YY|| YY|| YY|| YY|| YY|| YY|| YY|| 㗗՘Ǚ --zzGGqqcciibb!!\\##VV$$PP$$QQ##RR""RR QQQQQQQQQQQQQQQQޠТâ ss##ii>>aa[[YY{{SS MM!!HH""DD##FF!!HH IIIIIIIIIIIIIIIIII짧ݨϩªzzffZZ55RRRRKKssDD?? ;;!!88!!<< >>@@AAAAAAAAAAAAAAAAޮаİ}}mm]] JJ++CCJJ<> 33##))>> &&dd $$""!!"" $$ && ''''''''''''''''pp__HH66 ,,$$88!!ZZ !! "" "" "" "" "" "" "" yykkXXAA..%%22QQqquuddQQ<<&&,,GGdd  ~~oo^^KK77!!%%>>XX tt        yyiiXXEE22  55MMffssccRRAA..,,CC\\ww||mm]]MM<<++))@@WWoovvhhXXII99((((==RRii22,, **-- $$.. 002255<<BBHHOOVV^^eennvv   55(( --** &&++ --//3399@@FFMMUU\\eemmvv 88%% 11&& (('' ""**,,0066==DDKKSS[[ccllvv;;!! 44"" ,,$$ $$%% ((,,33::AAHHPPYYbbkkvv ""$$$$$$$$$$$$$$>> 77 // &&!! ##((//66 == EE!!NN""VV""``""jj""uu!!!!  $$&&(()) )) )) )) )) )) )) AA :: 33 ** ""## **!!22""99##BB $$JJ $$TT %%]] %%hh %%tt $$ $$ ## ""!! ##'')) ++ ,, -- -- -- -- -- -- -- DD >> 66 .. %%!!""%%$$,, %%55 &&== &&FF ''PP ''[[ ''ff ''ss '' '' && && %% %%** -- // 00 0011111111111111GG AA :: 22 (($$%% &&'' ''// ((88 ))AA ))LL **WW **cc **qq ** ** )) )) )) ,, 00 2233334444333333333333NN FF ?? 66,,((** ++ ++)) ++22 ++<<,,FF,,RR,,__,,nn,,,,,,,,,, 22445566666666666666666666TTNNFF >> 55 .. ..// 00!! 00++ 0055//@@..MM..[[..kk..}}....//44778888888888::;;;;;;;;;;;;[[ TT MM EE<<77 55 44 55 66"" 55--449933FF11TT00ff00{{00112299::;;::;; >>@@BBBBBBBBBBBBBB`` ZZRRJJAA==>> == ;; << <<##:://88==55MM22``22ww22000066==<<""@@""DD GGII~~JJ}}JJ}}JJ}}JJ}}JJ}}JJ}}JJdd^^VVLLAA??EEGGFF BB BB BB##??22<